WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00002053 Gene Name  ifb-1
Sequence Name  ? F10C1.2 Brief Description  ifb-1 (also known as vab-21) encodes two isoforms of an essential intermediate filament protein that is coexpressed with the essential IF proteins IFA-1, IFA-2, and IFA-3, along with IFA-4; IFB-1 is required for embryonic development and epidermal morphogenesis; IFB-1 forms heteropolymeric intermediate filaments in vitro with an equimolar mixture of IFA-1, IFA-2, or IFA-3, and binds IFA-4 in blot overlay assays; IFB-1 resides in attachment structures of epidermal cells, found in sites undergoing mechanical stress; the two isoforms are expressed in different tissues and have distinct functions, since ifb-1A(RNAi) larvae have detached muscle cells, while ifb-1B(RNAi) larvae have detached cuticle.
Organism  Caenorhabditis elegans Automated Description  Predicted to be a structural constituent of cytoskeleton. Predicted to be involved in several processes, including heterochromatin formation; nucleus organization; and protein localization to nuclear envelope. Located in apical plasma membrane. Expressed in several structures, including egg-laying apparatus; excretory system; pharyngeal-intestinal valve; pharynx; and somatic nervous system. Human ortholog(s) of this gene implicated in partial lipodystrophy; primary autosomal recessive microcephaly; and progressive myoclonus epilepsy 9. Is an ortholog of human LMNB2 (lamin B2).
Biotype  SO:0001217 Genetic Position  II :-0.952783 ±0.004521
Length (nt)  ? 6467
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00002053

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F10C1.2b.1 F10C1.2b.1 2187   II: 5765618-5772084
Transcript:F10C1.2a.1 F10C1.2a.1 2072   II: 5768945-5772070
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F10C1.2b F10C1.2b 1770   II: 5765642-5765774
CDS:F10C1.2a F10C1.2a 1677   II: 5768961-5769000

26 RNAi Result

WormBase ID
WBRNAi00063109
WBRNAi00063110
WBRNAi00098344
WBRNAi00063111
WBRNAi00062646
WBRNAi00044216
WBRNAi00044217
WBRNAi00027266
WBRNAi00025055
WBRNAi00008627
WBRNAi00066782
WBRNAi00013036
WBRNAi00025056
WBRNAi00094171
WBRNAi00094281
WBRNAi00071777
WBRNAi00112229
WBRNAi00071147
WBRNAi00071146
WBRNAi00113738
WBRNAi00030748
WBRNAi00007218
WBRNAi00062645
WBRNAi00063108
WBRNAi00113734
WBRNAi00103258

100 Allele

Public Name
gk963801
gk963053
gk964349
gk678399
ju71
WBVar01695526
WBVar01603922
tm10763
WBVar01437938
WBVar01437939
WBVar01437942
WBVar01373366
WBVar01719931
WBVar01719930
WBVar01783513
WBVar01413464
WBVar01982474
WBVar00234537
gk695295
gk649584
gk659688
gk411197
gk1411
gk609566
gk542246
gk926291
gk478834
gk407607
gk867859
gk511606

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00002053 5765618 5772084 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

236 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  oocyte proteins identified by two or more unique peptides during proteomics study. In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. WBPaper00038289:oocyte_protein
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
  Genes that were downregulated in lin-15B(n744). For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. WBPaper00038168:lin-15B(n744)_downregulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day11_vs_Day1_downregulated
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
mitochondrial sulfide delivery molecule (mtH2S) AP39 Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
  Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage. DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
Bacteria infection: Bacillus thuringiensis Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. N.A. WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Dietary restriction Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition. Bioconductor package edgeR, p < 0.05. WBPaper00056443:DietaryRestriction_downregulated
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
  Transcripts enriched in AMso according to single cell RNAseq. Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched. WBPaper00061651:AMso_enriched

17 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1031206 Tiling arrays expression graphs  
Also expressed in (comments from author) : No comments. Strain: BC14131 [F10C1.2a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGATCAACTATTAACTGAACCA] 3' and primer B 5' [AGCCTCCATTTCTGATGTGTTT] 3'. Expr5713 Adult Expression: rectal epithelium; hypodermis; seam cells; excretory cell; Larval Expression: rectal epithelium; hypodermis; seam cells; excretory cell;  
Cannot find sequence info for IF B1 in this article. --wjc. Protein_Description: Intermediate Filament gene B1. Reporter gene fusion type not specified. The same structures were seen in immunofluorescence experiments with a B1-specific antibody. This antibody recognized in immunoblots the recombinant protein B1a and two closely spaced bands in a total nematode extract.   Expr1497 The B1 promoter-driven GFP staining was seen in cells associated with the amphid sensory neurons, the excretory cells, the vulva, and the uterus and, finally, in the rectum and some neurons of the tail. In the pharynx, staining localized to the marginal cells and the pharyngeal-intestinal valve.  
  IFB-1BDGFP data were collected using the pCZ482 extrachromosomal array juEx595. Expr2857 IFB-1ADGFP was first detected in epidermal cells at the enclosure stage of embryogenesis. By the 1.5-fold stage, IFB-1ADGFP began to accumulate in regions of epidermal cells adjacent to body wall muscles. In addition to epidermal and pharyngeal expression, both IFB-1 isoforms were expressed in other cell types. Both isoforms were localized to the processes of the excretory cell and the excretory duct. IFB-1B, but not IFB-1A, transgenes were highly expressed in the uterine epithelium. Prominent expression of IFB-1 isoforms was also observed in the pharynx. Both IFB-1A and IFB-1B are expressed in marginal cells of the pharynx. IFB-1BDGFP transgenes were expressed throughout the length of the pharynx, whereas IFB-1ADGFP transgenes were expressed in a subset of pharyngeal marginal cells. In pharyngeal marginal and muscle cells, Myotactin is localized basally, whereas IFB-1ADGFP and IFB-1BDGFP were distributed throughout the apicalbasal axis. These data confirm previous reports of anti-IFB-1 staining in pharyngeal marginal cells. In embryos after the 2-fold stage, larvae, and adults, IFB-1ADGFP localized to circumferential stripes in the parts of the epidermis that contact body wall muscles and in double tracks corresponding to epidermis overlying the processes of mechanosensory neurons; these patterns of subcellular localization correspond to epidermal attachment structures, also known as fibrous organelles. IFB-1BDGFP was also expressed in the epidermis in a pattern indistinguishable from that of IFB-1A. Thus, both isoforms of IFB-1 are expressed in the epidermis and localized to the same subcellular compartments. The monoclonal antibody MH4 recognizes an epitope common to IFA-1, IFA-2, and IFA-3, and does not recognize IFB-1. MH4 staining and IFB-1ADGFP expression co-localized in both embryonic and adult epidermal cells. In the adult epidermis, IFB-1ADGFP partly co-localized with Myotactin, a transmembrane protein that localizes to or close to the basal parts of epidermal attachments.
    Expr2763 The B1a promoter/gfp reporter was strongly expressed in the embryonic and the early larval hypodermis. Additional expression was seen in cells associated with the amphid sensory neurons, the excretory cells, the vulva, the nerve cord and the rectum, as well as in some neurons of the tail of the late larva or the juvenile. A similar expression pattern was detected in adults, which, however, lacked the hypodermal expression seen at earlier developmental stages.  
    Expr15156 We found that the two isoforms IFB-1A and IFB-1B, fused to GFP and directed by their own promoters, were similarly expressed in canals, albeit differentially in other tissues. Both IFB-1A and IFB-1B were absent at lumen initiation and first appeared in laterally extending canals, where they persisted through anterior-posterior canal extension and thereafter. Double-labeling canals with cytoplasmic mCherry localized both GFP-labeled isoforms to the lumen.  
    Expr12515 IFB-1::GFP is expressed in fibrous organelles (hemidesmosomes), uterine seam, and the excretory canal.  
    Expr2012679 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1011188 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1170026 Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191  
    Expr2030915 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1200364 Data from the TransgeneOme project  
    Expr15158   To optimize comparative imaging of all canal cIFs and their isoforms during canal lumenogenesis, ifa-4, ifb-1b, ifc-2a, and ifc-2b cDNAs were cloned behind the canal-specific sulp-5 promoter and fused to different fluorophores. All localized to expanding larval and fully expanded adult lumenal membranes adjacent to but distinct from lumenal ERM-1. Thus, all C. elegans canal cIFs and their isoforms are located at the lumen.
    Expr1148176 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1200365 Data from the TransgeneOme project  
No detailed description on cellular expression patterns in other tissue.   Expr2858 Anti-IFB-1 was previously reported to stain several non-epidermal cell types. Anti-IFB-1 staining in these cells was confirmed; however, in addition, consistent anti-IFB-1 staining was observed in epidermal attachment structures. The expression patterns of the GFP-tagged IFB-1 transgenes support the conclusion that this anti-IFB-1 staining in epidermal cells is specific. Expressed in epidermal attachment structures.
Original chronogram file: chronogram.725.xml [F10C1.2:gfp] transcriptional fusion. Chronogram1814    

16 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in
  enables
  enables
  enables
  located_in
  located_in
  involved_in
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
part_of(WBbt:0005812) located_in
  located_in
  located_in

13 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00002053 5765618 5772084 1

16 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in
  enables
  enables
  enables
  located_in
  located_in
  involved_in
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
part_of(WBbt:0005812) located_in
  located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
6467

1 Sequence Ontology Term

Identifier Name Description
gene  

8 Strains

WormBase ID
WBStrain00030106
WBStrain00030105
WBStrain00031953
WBStrain00032433
WBStrain00002879
WBStrain00005392
WBStrain00005384
WBStrain00005396

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_5765402..5765617   216 II: 5765402-5765617 Caenorhabditis elegans