WormMine: Gene WBGene00002215

• WormBase Gene ID: WBGene00002215
• Gene Name: klc-2
• Sequence Name: C18C4.10
• Brief Description: klc-2 encodes a kinesin light chain; klc-2 is required for transport and localization of synaptic vesicles to presynaptic terminals; in addition, klc-2 is required for normal translocation of the meiotic spindle to the oocyte cortex; KLC-2 physically interacts with UNC-116/kinesin heavy chain (KHC) and with UNC-16 and UNC-14, suggesting that it regulates vesicular transport by mediating the association between UNC-116/KHC and synaptic vesicles; a KLC-2::GFP fusion protein is widely expressed and seen in neurons, muscle, and the pharynx; in neurons, KLC-2::GFP exhibits diffuse localization.
• Organism: Caenorhabditis elegans
• Automated Description: Enables kinesin binding activity. Involved in several processes, including axon extension; establishment of organelle localization; and polar body extrusion after meiotic divisions. Located in cytoplasm and nuclear envelope. Part of kinesin I complex. Expressed in body ganglion; muscle cell; pharynx; and somatic nervous system. Human ortholog(s) of this gene implicated in Alzheimer's disease; SPOAN syndrome; and relapsing-remitting multiple sclerosis. Is an ortholog of human KLC1 (kinesin light chain 1) and KLC2 (kinesin light chain 2).
• Biotype: SO:0001217
• Genetic Position: V :-1.48452 ±0.026086
• Length (nt): 4941

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002215

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C18C4.10c.1	C18C4.10c.1	1718	V: 5576472-5579535
Transcript:C18C4.10b.2	C18C4.10b.2	2388	V: 5576472-5581412
Transcript:C18C4.10a.1	C18C4.10a.1	1806	V: 5576478-5581403
Transcript:C18C4.10b.3	C18C4.10b.3	2004	V: 5576730-5579530
Transcript:C18C4.10b.1	C18C4.10b.1	2014	V: 5576737-5579529

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C18C4.10a	C18C4.10a	1569	V: 5576653-5576694
CDS:C18C4.10b	C18C4.10b	1623	V: 5577103-5577261
CDS:C18C4.10c	C18C4.10c	1506	V: 5576653-5576694

12 RNAi Result

• WBRNAi00110545
• WBRNAi00040912
• WBRNAi00080577
• WBRNAi00079261
• WBRNAi00030280
• WBRNAi00079259
• WBRNAi00079258
• WBRNAi00079255
• WBRNAi00079257
• WBRNAi00079256
• WBRNAi00079263
• WBRNAi00079264

67 Allele

• gk963301
• WBVar02060143
• WBVar02060144
• gk963591
• gk963553
• gk964259
• gk964351
• gk963850
• gk964051
• WBVar01862299
• WBVar01862300
• WBVar01862301
• WBVar01973522
• WBVar00209477
• WBVar00209478
• WBVar00209479
• WBVar00209475
• WBVar00209476
• WBVar00209480
• WBVar00209481
• WBVar00209482
• WBVar00209483
• WBVar01459972
• WBVar01459973
• h9754
• gk960998
• WBVar01808054
• gk2641
• gk840204
• gk791921

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002215
• Start: 5576472
• End: 5581412
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_5576374..5576471
• Length (nt): 98
• Chromosome Location: V: 5576374-5576471
• Organism: Caenorhabditis elegans

142 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Genes that showed increased expression after germline ablation comparing to un-ablated animals.	The differential expression between germline-ablated versus gonad-ablated animals was computed via the functions makeContrasts and contrasts.fit in the limma package in R/Bioconductor.	WBPaper00045571:germline-ablation_upregulated
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Transcripts that showed significantly increased expression after N2 animals were exposed to BL21 bacteria carrying pET28a-cry5B, comparing to animals exposed to BL21 control bacteria.	Differentially expressed genes were identified through fold change as well as P value calculated with t-test. The threshold set for up- and down-regulated genes was a fold change >= 2.0 and a P value <= 0.05.	WBPaper00065732:Cry5Ba_upregulated_N2
	Transcripts that showed significantly increased expression in pgl-1(ct131) animals (isolated from SS0002[pgl-1(ct131)him-3(e1147)], comparing to in control animals SS1174, at 1-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_pgl-1(ct131)_vs_control_day1-adult
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated

9 Expression Patterns

• Primary Identifier: Expr5301
• Remark: Strain: BC11100
• Reporter Gene: [klc-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCCTTTTTCCGTTCAACAGT] 3' and primer B 5' [CGGCCAAATTCATGATGG] 3'.
• Pattern: Adult Expression: anal depressor muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: anal depressor muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr1031295
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr3209
• Pattern: Expression of the UNC-116::GFP and KLC-2::GFP fusion proteins was seen broadly in multiple tissues including most of the neurons, muscles, and pharynx.
• Subcellular Localization: The GFP expression within a given cell was in general diffuse and excluded from the nucleus.

• Primary Identifier: Expr8662
• Remark: Picture: Fig 3C, 3D, Fig 4.
• Subcellular Localization: Expression of both proteins, as observed in immunofluorescence assays, was low in the early embryo and increased markedly in hypodermal cells by the pre-coma stage, during which hyp7 nuclear migration takes place. In wild-type pre-comma embryos, KLC-2 and UNC-116 expression was seen in many cells, including hyp7 precursors at the time of nuclear migration, and was primarily cytoplasmic. There might have been a slight enrichment of kinesin-1 at the nuclear envelope of migrating nuclei as compared with other hypodermal nuclei.

• Primary Identifier: Chronogram513
• Remark: Original chronogram file: chronogram.1529.xml
• Reporter Gene: [C18C4.10:gfp] transcriptional fusion.

• Primary Identifier: Expr2012948
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1144957
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1012871
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2031180
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

32 GO Annotation

16 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002215
• Start: 5576472
• End: 5581412
• Strand: -1

32 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4941

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00050735
• WBStrain00001630

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_5581413..5582800
• Length (nt): 1388
• Chromosome Location: V: 5581413-5582800
• Organism: Caenorhabditis elegans