WormMine: Gene WBGene00002257

• WormBase Gene ID: WBGene00002257
• Gene Name: lbp-5
• Sequence Name: W02D3.7
• Brief Description: lbp-5 encodes a predicted intracellular fatty acid binding protein (iFABP) that is most similar to the vertebrate muscle and heart FABPs; by homology, LBP-5 is predicted to function as an intracellular transporter for small hydrophobic molecules such as lipids and steroid hormones; loss of lbp-5 activity via large-scale RNAi screens indicates that, in C. elegans, LBP-5 is required for movement.
• Organism: Caenorhabditis elegans
• Automated Description: Enables fatty acid binding activity. Predicted to be involved in fatty acid transport. Located in nucleus and perinuclear region of cytoplasm. Expressed in hypodermis and tail. Human ortholog(s) of this gene implicated in Charcot-Marie-Tooth disease type 1G; glioblastoma; and pre-eclampsia. Is an ortholog of several human genes including FABP4 (fatty acid binding protein 4); FABP7 (fatty acid binding protein 7); and PMP2 (peripheral myelin protein 2).
• Biotype: SO:0001217
• Genetic Position: I :1.30111 ±0.000265
• Length (nt): 1010

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002257

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:W02D3.7.1	W02D3.7.1	481	I: 6731267-6732276

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:W02D3.7	W02D3.7	411	I: 6731330-6731530

8 RNAi Result

• WBRNAi00066088
• WBRNAi00054592
• WBRNAi00004376
• WBRNAi00102246
• WBRNAi00036187
• WBRNAi00116837
• WBRNAi00102646
• WBRNAi00088958

11 Allele

• gk962858
• gk962706
• gk963902
• gk874523
• gk599064
• gk676756
• gk380888
• tm1618
• gk113570
• gk874522
• gk618114

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002257
• Start: 6731267
• End: 6732276
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_6730960..6731266
• Length (nt): 307
• Chromosome Location: I: 6730960-6731266
• Organism: Caenorhabditis elegans

246 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults.	Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05.	WBPaper00061530:nhr-49(e2144)_downregulated
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Genes that were downregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_downregulated
	Transcripts that showed significantly decreased expression in morc-1(tm6048) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_morc-1(tm6048)_downregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly increased expression in nhr-114(gk849) comparing to wild type animals at L4 larva.	DESeq2 1.26.0, fold change > 2, FDR < 0.05.	WBPaper00064539:nhr-114(gk849)_upregulated
	Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines.	RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1.	WBPaper00035269:cde-1_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Expression Pattern Group C, enriched for genes involved in metabolic processes.	The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05.	WBPaper00036286:Pattern_C
	Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh6), triggered by the dafachronic acid (DA) growth hormone. Cluster 3 genes increased expression transiently at 26 hour post hatching.	Benjamini Hochberg corrected q-value < 0.01.	WBPaper00053388:dauer_regulated_Cluster3
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted

9 Expression Patterns

• Primary Identifier: Expr6825
• Remark: Strain: BC14538
• Reporter Gene: [lbp-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGAACCGCTTAAAATCATTGAG] 3' and primer B 5' [CAGCAGAGATTCTGAAAATTTGG] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; intestine; Reproductive System; vulva other; seam cells; unidentified cells in tail ; Larval Expression: pharynx; arcade cells; intestine; seam cells; unidentified cells in tail

• Primary Identifier: Expr9583
• Pattern: LBP-5-GFP was observed in the intestine during all larval stages. The fusion protein was also detected in adult nematodes. Expression in individual seam cells was often highly punctate, and strong GFP expression was observed in these cells in the L4 larval and adult stages. GFP expression was observed during embryogenesis and in all subsequent larval and adult stages. LBP-5 protein was expressed widely in many different cell types, indicating that LBP-5 most likely plays important roles throughout the entire worm body. In particular, LBP-5 expression is high within the hypodermis and intestine, which are major sites of fat accumulation.
• Subcellular Localization: LBP-5-GFP was detected in large intestinal nuclei, and as punctate staining in the nuclear region of seam cells.

• Primary Identifier: Expr2013022
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1158136
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1868
• Remark: Original chronogram file: chronogram.786.xml
• Reporter Gene: [W02D3.7:gfp] transcriptional fusion.

• Primary Identifier: Expr2031254
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1902
• Remark: Original chronogram file: chronogram.823.xml
• Reporter Gene: [W02D3.7:gfp] transcriptional fusion.

• Primary Identifier: Expr1027724
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1961
• Remark: Original chronogram file: chronogram.879.xml
• Reporter Gene: [W02D3.7:gfp] transcriptional fusion.

9 GO Annotation

58 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002257
• Start: 6731267
• End: 6732276
• Strand: -1

9 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins with increased expression in lbp-5(tm1618) comparing to in N2 according to 2-dimensional eletrophoresisis.	Student t-test with p-value < 0.05.	WBPaper00044427:lbp-5(tm1618)_upregulated
	Proteins with decreased expression in lbp-5(tm1618) comparing to in N2 according to 2-dimensional eletrophoresisis.	Student t-test with p-value < 0.05.	WBPaper00044427:lbp-5(tm1618)_downregulated

1 Sequence

• Length: 1010

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00055607

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_6732277..6734027
• Length (nt): 1751
• Chromosome Location: I: 6732277-6734027
• Organism: Caenorhabditis elegans