WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00002987 Gene Name  lim-4
Sequence Name  ? ZC64.4 Brief Description  lim-4 encodes a LIM homeodomain protein homologous to murine Lhx6 and L3/Lhx7, and to Drosophila ARROWHEAD; LIM-4 is required for differentiation of AWB chemosensory neurons, for several but not all aspects of RID motor neuron differentiation, expression of ser-2, repulsion from chemosensory repellants, SAA neurite outgrowth, and normal locomotion and head foraging; lim-4 is expressed in AWB, RID, RIV, RMDL, RMDR, RMEV, four SAA neurons, and four SIA neurons.
Organism  Caenorhabditis elegans Automated Description  Enables DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Involved in several processes, including cell differentiation; positive regulation of transcription by RNA polymerase II; and serotonin biosynthetic process. Located in nucleus. Expressed in several structures, including ABalpppppa; head muscle; head neurons; lumbar neurons; and somatic nervous system. Is an ortholog of human LHX6 (LIM homeobox 6) and LHX8 (LIM homeobox 8).
Biotype  SO:0001217 Genetic Position  X :-9.21387 ±0.024615
Length (nt)  ? 4142
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00002987

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:ZC64.4a.1 ZC64.4a.1 1666   X: 3869404-3873544
Transcript:ZC64.4b.1 ZC64.4b.1 1640   X: 3869404-3873545
Transcript:ZC64.4c.1 ZC64.4c.1 1481   X: 3869407-3873395
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:ZC64.4c ZC64.4c 1035   X: 3869753-3869810
CDS:ZC64.4a ZC64.4a 1068   X: 3869753-3869810
CDS:ZC64.4b ZC64.4b 1041   X: 3869753-3869810

3 RNAi Result

WormBase ID
WBRNAi00059017
WBRNAi00021755
WBRNAi00093991

81 Allele

Public Name
gk963725
gk964260
gk963632
tm11267
WBVar02123730
WBVar01601412
WBVar00077294
WBVar00077293
tm249
WBVar01825099
gk451609
gk350892
gk333436
ky395
gk319286
gk677097
ky403
ky402
gk685303
gk532422
gk341250
gk663657
gk532423
gk396058
gk695027
gk429889
gk648345
gk678801
gk534435
gk733923

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00002987 3869404 3873545 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_3868027..3869403   1377 X: 3868027-3869403 Caenorhabditis elegans

141 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
  Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C. DESeq2, fold change > 2, p-value < 0.05. WBPaper00061753:csr-1(tor159)_upregulated_25C
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin_upregulated
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_18
  Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage. DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2. DESeq 2, fold change > 2, FDR < 0.05. WBPaper00065581:hpk-1(pk1393)_upregulated
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated
  Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain. RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis. WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. DESeq2, FDR <0.05, fold change > 2. WBPaper00059664:srbc-48(ac23)_upregulated
  Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage. DESeq v1.6.3. Fold change > 1.5. WBPaper00050370:dpy-21(e428)_L3_upregulated
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated

16 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1031386 Tiling arrays expression graphs  
    Expr1162449 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
Clone: pUL#JRH8G11   Expr7755 From late embryo to adult, expression is seen in the dorsal and ventral nerve cords and two other pairs of nerves in the head, one pair with processes to the tip of head, the other with processes to the nerve ring and then down the dorsal side to tail. There is also weak expression in head muscles and intestine.  
    Expr15380    
Reporter gene fusion type not specified.   Expr1334 In larvae and adults, lim-4::GFP expression was confined to neurons in the worm's anterior ganglia; embryonic expression was not examined in detail. Expression from both transgenes was observed in the AWB neurons but not in other sensory neurons. lim-4::GFP1 was also expressed in one RME motor neuron (RMEV), two RMD motor neurons (RMDL and RMDR), and the RID, RIV, SAA and SIA interneurons. lim-4::GFP2 was expressed in the same neurons, except for RID and RMEV. Expression in the GABAergic RME motor neurons, which control head movement. In a subsequent study, lim-4 was found to be expressed in SMB neurons, other than SIA neurons (Kim et al., 2015; Expr12499).  
This myc::lim-4 transgene potently rescues ADF serotonergic phenotype in yz12 mutants, indicating that the MYC::LIM-4 protein is expressed in cells necessary to specify ADF serotonergic identity.   Expr3765 To examine lim-4 expression during the embryogenesis, the eggs were stained at various developing stages with anti-myc antibodies. A GFP reporter was used for the GATA gene elt-2, which is specifically expressed in the gut lineage, to stage the embryos. MYC::LIM-4 immunoreactivity is first detected in two cells approximately 160 min post-fertilization at 8 gut nuclei stage. The two MYC::LIM-4-staining cells was identified as the neuroblasts ABalpppppa and ABpraaappa that respectively give rise to left/right ADF and AWB neurons, based on triple labeling of the embryos with antibodies raised against the LIN-26 protein, which is expressed in the nuclei of the hypodermal cells that border the ADF/AWB mother cells. Like lim-4::gfp, the MYC::LIM-4 immunoreactivity is not detected in ADF at any stage of larvae or adults, but it is observed in AWB and several other neurons in the head throughout life (N > 200). It is difficult to determine if LIM-4 is excluded from ADF or it is present there transiently.  
    Expr12724    
    Expr15624    
Strain: BC11853 [lim-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGGAACTTTTTCGGTTGTTTG] 3' and primer B 5' [ATCGATGGTGCAACTTGTGA] 3'. Expr7176 Adult Expression: Nervous System; nerve ring; Larval Expression: Nervous System; nerve ring;  
    Expr12499 lim-4 is expressed in the SMB neurons rather than the SIA neurons, as previously described (Sagasti et al., 1999; Expr1334). lim-4 expression in the SMB neurons gradually decreased from the L1 larval stage until it became undetectable in the adult stage.  
Original chronogram file: chronogram.1967.xml [ZC64.4:gfp] transcriptional fusion. Chronogram919    
    Expr2013151 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1027177 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2031383 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1170048 Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191  
Original chronogram file: chronogram.2581.xml [ZC64.4:gfp] transcriptional fusion. Chronogram1336    

23 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  located_in
  located_in
  involved_in
has_input(WB:WBGene00004777),occurs_in(WBbt:0003938) involved_in
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
occurs_in(WBbt:0003938) involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in

9 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
orthologue
orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00002987 3869404 3873545 -1

23 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  located_in
  located_in
  involved_in
has_input(WB:WBGene00004777),occurs_in(WBbt:0003938) involved_in
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
occurs_in(WBbt:0003938) involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
4142

1 Sequence Ontology Term

Identifier Name Description
gene  

5 Strains

WormBase ID
WBStrain00023455
WBStrain00029156
WBStrain00049271
WBStrain00001913
WBStrain00005258

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_3873546..3875840   2295 X: 3873546-3875840 Caenorhabditis elegans