WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00003112 Gene Name  mab-21
Sequence Name  ? F35G12.6 Brief Description  mab-21 encodes a novel protein that is a member of a highly conserved family of proteins with Drosophila and vertebrate orthologs; MAB-21 is cell-autonomously required for specifying the identity of sensory ray 6 in the male tail, and also for backward locomotion, normal body morphology, fecundity, and embryonic morphogenesis; MAB-21 expression begins in embryonic hypodermal cells and continues in larval and adult animals in hypodermis, anterior and ventral cord neurons, some body wall muscles, and ray cells.
Organism  Caenorhabditis elegans Automated Description  Involved in cell fate commitment; embryo development; and nematode male tail mating organ morphogenesis. Expressed in several structures, including PVC; VA2; hyp7 syncytium; ray 6; and sensory neurons. Human ortholog(s) of this gene implicated in coloboma and syndromic microphthalmia 14. Is an ortholog of human MAB21L1 (mab-21 like 1) and MAB21L2 (mab-21 like 2).
Biotype  SO:0001217 Genetic Position  III :-3.02765 ±0.006765
Length (nt)  ? 2300
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00003112

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F35G12.6.1 F35G12.6.1 1246   III: 4600753-4603052
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F35G12.6 F35G12.6 1095   III: 4600820-4600852

26 RNAi Result

WormBase ID
WBRNAi00067386
WBRNAi00002119
WBRNAi00046400
WBRNAi00046401
WBRNAi00014369
WBRNAi00005031
WBRNAi00077451
WBRNAi00030781
WBRNAi00069594
WBRNAi00069593
WBRNAi00065907
WBRNAi00065909
WBRNAi00069580
WBRNAi00069579
WBRNAi00069582
WBRNAi00069581
WBRNAi00069584
WBRNAi00069583
WBRNAi00069586
WBRNAi00069585
WBRNAi00069588
WBRNAi00069587
WBRNAi00069590
WBRNAi00069589
WBRNAi00069592
WBRNAi00069591

30 Allele

Public Name
WBVar01263158
WBVar01263159
sy155
h5273
WBVar01898716
bx41
bx43
bx53
WBVar01785517
WBVar01785518
gk173088
gk173087
gk173090
gk173089
gk173084
WBVar01445360
gk173086
gk173085
gk888178
gk782322
gk715831
gk782323
gk392720
gk409354
gk751968
gk888177
WBVar01566337
WBVar01837477
gk909346
gk323769

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00003112 4600753 4603052 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

154 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_upregulated
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2. DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1. WBPaper00046012:tdp-1(ok803)_upregulated
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. edgeR, fold change > 2, FDR < 0.05 WBPaper00060909:atfs-1(cmh15)_downregulated
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage. DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
  Transcripts expressed in vulva. FPKM >= 1. WBPaper00064122:vulva_transcriptome
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2. DESeq2, Fold change > 1.5. WBPaper00051404:alg-1(gk214)_upregulated
  Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage. DESeq2, fold change > 2 WBPaper00058725:sftb-1(cer6)_downregulated
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts that showed significantly increased expression in xrep-4(lax137). DESeq2. Genes were selected if their p value < 0.01. WBPaper00066062:xrep-4(lax137)_upregulated
  Transcripts that showed significantly increased expression in isp-1(qm150) comparing to in N2. Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. WBPaper00053810:isp-1(qm150)_upregulated
  Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2. Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. WBPaper00053810:nuo-6(qm200)_upregulated
  Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2. DESeq 2, fold change > 2, FDR < 0.05. WBPaper00065581:hpk-1(pk1393)_upregulated
  Transcripts that showed significantly increased expression in pie-1(ne4443[PIE-1-Degron-GFP]) DESeq2. Differentially expressed genes were defined as twofold change and adjusted p-value less than 0.05. WBPaper00061478:pie-1(ne4433)_upregulated
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated

12 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1031471 Tiling arrays expression graphs  
Strain: BC12444 [mab-21::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCTTCTGAACATAGTTGGTGCC] 3' and primer B 5' [CATGTTGGACAAGCGGAAA] 3'. Expr5958 Adult Expression: intestine; body wall muscle; Larval Expression: intestine;  
Strain: BC12758 [mab-21::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCTTCTGAACATAGTTGGTGCC] 3' and primer B 5' [CATGTTGGACAAGCGGAAA] 3'. Expr5959 Adult Expression: body wall muscle; hypodermis; Nervous System; head neurons; Larval Expression: body wall muscle; hypodermis; Nervous System; head neurons;  
    Expr7321 Click the movie links below for interactive 4D movies of a fluorescence reporter. http://glowormnotes.blogspot.com/2009/11/mab-21yfp-transcriptional-fusion.html  
    Expr1628 In wild-type animals, the mab-21::gfp fluorescent signal was first observed in embryos at the beginning of gastrulation. The expressing cells were dorsal hyp 7 cells before their fusion. From this stage on, the signal could be detected in other larval and adult animals in tissues including hypodermal cells, a group of neuronal cells near the pharyngeal bulbs, neurons along the ventral nerve cord, some body wall muscles and the ray cells. Neuronal cells around the anal ganglia region identified as HOA, HOB in the males as well as PLM, PQR, and PVC. In addition to two unidentified anterior neurons, AVM and VA3 were also confirmed to express mab-21::gfp. The mab-21::gfp fusion transgene was expressed in neuron A of all rays, neuron B of rays 3 and 6 and more importantly, the structural cell of only ray 6.  
    Expr12562    
    Expr1150271 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
Original chronogram file: chronogram.1410.xml [F35G12.6:gfp] transcriptional fusion. Chronogram398    
    Expr2013324 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1026880 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2031556 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.34.xml [F35G12.6:gfp] transcriptional fusion. Chronogram1462    

4 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in

10 Homologues

Type
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00003112 4600753 4603052 1

4 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
2300

1 Sequence Ontology Term

Identifier Name Description
gene  

4 Strains

WormBase ID
WBStrain00030819
WBStrain00007166
WBStrain00007160
WBStrain00002152

0 Upstream Intergenic Region