WormMine: Gene WBGene00003159

• WormBase Gene ID: WBGene00003159
• Gene Name: mcm-7
• Sequence Name: F32D1.10
• Brief Description: mcm-7 encodes the C. elegans ortholog of the MCM7 member of the MCM complex, a hexameric protein complex required for the initiation and regulation of DNA replication.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable single-stranded DNA binding activity. Predicted to contribute to single-stranded DNA helicase activity. Involved in MCM complex assembly; embryo development; and mitotic sister chromatid segregation. Predicted to be located in nucleus. Predicted to be part of MCM complex. Expressed in several structures, including anchor cell; intestine; tail; uterine epithelial cell; and vulval precursor cell. Human ortholog(s) of this gene implicated in hepatocellular carcinoma and pancreatic ductal carcinoma. Is an ortholog of human MCM7 (minichromosome maintenance complex component 7).
• Biotype: SO:0001217
• Genetic Position: V :-5.85076 ±0.013093
• Length (nt): 2603

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003159

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F32D1.10.1	F32D1.10.1	2449	V: 4347166-4349768

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F32D1.10	F32D1.10	2193	V: 4347198-4347299

13 RNAi Result

• WBRNAi00073067
• WBRNAi00073069
• WBRNAi00073068
• WBRNAi00031672
• WBRNAi00046122
• WBRNAi00075576
• WBRNAi00008735
• WBRNAi00066439
• WBRNAi00008067
• WBRNAi00025356
• WBRNAi00065878
• WBRNAi00111654
• WBRNAi00065720

80 Allele

• gk963301
• gk963591
• gk963553
• gk964259
• gk964351
• gk963850
• gk964431
• WBVar01972990
• gk716024
• gk390903
• gk843559
• gk464240
• gk452379
• gk435290
• gk419256
• gk389900
• gk346209
• gk658069
• gk681767
• gk458256
• gk341759
• gk384430
• WBVar01650353
• WBVar01677502
• WBVar00208150
• WBVar00585183
• WBVar01677528
• WBVar01677527
• WBVar01677530
• WBVar01677529

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003159
• Start: 4347166
• End: 4349768
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

299 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults.	Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05.	WBPaper00061530:nhr-49(e2144)_downregulated
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_downregulated
starvation 12 hours	Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals.	EdgeR, FDR < 0.05, fold change >= 2.	WBPaper00067259:starvation_upregulated_intestine
	Transcripts that showed significantly increased expression in enriched nuclei of daf-2(e1370) comparing to in wild type nuclei.	edgeR, fold change > 2, FDR < 0.05	WBPaper00067267:daf-2(e1370)_upregulated_nuclei
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1

11 Expression Patterns

• Primary Identifier: Expr1031494
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5933
• Remark: Also expressed in (comments from author) : larval GFP expression stops at L1. Strain: BC10326
• Reporter Gene: [mcm-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAAACAAAGAAAAACCGCAAT] 3' and primer B 5' [TATAGAGCCGGGCTGAAATG] 3'.
• Pattern: Adult Expression: unidentified cells; Larval Expression: unidentified cells; unidentified cells in head; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5934
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11203
• Reporter Gene: [mcm-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAAACAAAGAAAAACCGCAAT] 3' and primer B 5' [TATAGAGCCGGGCTGAAATG] 3'.
• Pattern: Adult Expression: pharynx; intestine - anterior cells; body wall muscle; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; intestine - anterior cells; body wall muscle; unidentified cells in head; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr1150005
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr16207
• Pattern: In mid-L2 larvae, GFP::MCM-7 was expressed at comparably lower levels in the newly specified AC. During the late L2 and early L3 stage, GFP::MCM-7 expression in the AC further declined but was still detectable in mid- L3 larvae just prior to invasion. In late L3 larvae, after the BM had been breached, no GFP:: MCM-7 expression was detectable in the AC.

• Primary Identifier: Chronogram284
• Remark: Original chronogram file: chronogram.1307.xml
• Reporter Gene: [F32D1.10:gfp] transcriptional fusion.

• Primary Identifier: Expr16206
• Pattern: zh118[frt::gfp::mcm-7] animals exhibited GFP::MCM-7 expression in the nuclei of proliferating cells, including many uterine cells and the VPCs.

• Primary Identifier: Expr1023551
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2013454
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram2075
• Remark: Original chronogram file: chronogram.990.xml
• Reporter Gene: [F32D1.10:gfp] transcriptional fusion.

• Primary Identifier: Expr2031688
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

30 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003159
• Start: 4347166
• End: 4349768
• Strand: 1

30 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2603

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00063070
• WBStrain00001281
• WBStrain00001671
• WBStrain00001670
• WBStrain00001282

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_4346426..4347165
• Length (nt): 740
• Chromosome Location: V: 4346426-4347165
• Organism: Caenorhabditis elegans