WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: unidentified cells; Larval Expression: unidentified cells; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Primary Identifier  Expr5933
Remark  Also expressed in (comments from author) : larval GFP expression stops at L1. Strain: BC10326 Reporter Gene  [mcm-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAAACAAAGAAAAACCGCAAT] 3' and primer B 5' [TATAGAGCCGGGCTGAAATG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
posterior region, from rectum to the end tail   WBbt:0005741
anterior-most body region containing the pharynx. head   WBbt:0005739
region of the body by which tissues, cells or cell parts are classified body region   WBbt:0005738

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003159 mcm-7 F32D1.10 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023