Genomics
3 Transcripts
Class | WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|---|
MRNA | Transcript:Y75B8A.2a.1 | Y75B8A.2a.1 |
1096
![]() |
III: 12077793-12084316 |
MRNA | Transcript:Y75B8A.2b.1 | Y75B8A.2b.1 |
279
![]() |
III: 12078103-12079435 |
NcPrimaryTranscript | Transcript:Y75B8A.2c | Y75B8A.2c |
1786
![]() |
III: 12078103-12084262 |
Other
2 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:Y75B8A.2a | Y75B8A.2a |
732
![]() |
III: 12078103-12078201 |
CDS:Y75B8A.2b | Y75B8A.2b |
279
![]() |
III: 12078103-12078201 |
62 RNAi Result
142 Allele
Public Name |
---|
gk963887 |
gk964363 |
gk964364 |
gk187531 |
gk187532 |
gk187533 |
gk187534 |
gk187535 |
gk187536 |
gk187537 |
gk187538 |
gk187539 |
gk187540 |
gk187541 |
gk187524 |
gk187525 |
gk187526 |
gk187527 |
gk187528 |
gk187529 |
gk187530 |
WBVar00180980 |
WBVar00180981 |
WBVar00180982 |
WBVar00180983 |
gk944924 |
h16339 |
WBVar00237570 |
WBVar01271630 |
WBVar01271629 |
1 Chromosome Location
Feature . Primary Identifier |
Start | End | Strand |
---|---|---|---|
WBGene00003779 | 12077793 | 12084316 | -1 |
3 Data Sets
Name | URL |
---|---|
WormBaseAcedbConverter | |
GO Annotation data set | |
C. elegans genomic annotations (GFF3 Gene) |
1 Downstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrIII_12077557..12077792 | 236 | III: 12077557-12077792 | Caenorhabditis elegans |
139 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
Genes that were downregulated in lin-15B(n744). | For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. | WBPaper00038168:lin-15B(n744)_downregulated | |
Genes that were upregulated in lin-15B(n744). | For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. | WBPaper00038168:lin-15B(n744)_upregulated | |
Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day5_vs_Day1_downregulated | |
Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day11_vs_Day1_downregulated | |
Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. | edgeR, fold change > 2, FDR < 0.05 | WBPaper00060909:atfs-1(cmh15)_downregulated | |
Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_regulated_aging | |
Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. | Fold change > 2. | WBPaper00064306:Agaro-oligosaccharides_upregulated | |
Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. | Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:S.aureus-4h_upregulated_N2 |
Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background | |
Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. | DESeq2 version 1.22.2, p < 0.05 | WBPaper00064716:paraquat_downregulated | |
Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated | |
Transcripts that showed significantly decreased expression in dissected female germline comparing to in dissected male germline. | Log2 Fold change > 2 or <-1, p-value < 0.05. | WBPaper00053599:female_vs_male_downregulated | |
Reduced humidity (98% relative humidity). | Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis. | Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001. | WBPaper00044578:reduced-humidity_downregulated_microarray |
Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:nuo-6(qm200)_upregulated | |
Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. | Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. | WBPaper00061479:hda-1(ne4752)_upregulated | |
Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. | DESeq2, FDR <0.05, fold change > 2. | WBPaper00059664:srbc-48(ac23)_upregulated | |
Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals. | Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed. | WBPaper00062193:skn-1(RNAi)_upregulated | |
Transcripts that showed significantly increased expression in pry-1(mu38) animals comparing to in N2 at L1 larva stage. | DESeq, FDR < 0.05 | WBPaper00055626:pry-1(mu38)_upregulated | |
Transcripts that showed higher expression in neurons isolated from male day 2 vs day 8. | DESeq2 analysis was then employed for read normalization and differential expression analysis of the counted reads. PCA analysiswas performed along with the DESeq2 package. Genes with a log2(fold-change) > 1 and p-adjusted < 0.05 were considered differentially expressed in subsequent analysis. | WBPaper00066831:male-neuron_aging_downregulated | |
Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. | DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. | WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult | |
Transcripts unqiuely expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_enriched | |
Transcripts that showed significantly increased expression in rict-1(mg360) comparing to in N2 at day 1 adult stage. | DESeq2, FDR < 0.01, fold change > 2. | WBPaper00066970:rict-1(mg360)_upregulated | |
heat-shock hlh-1 | Genes enriched in HLH-1 heat shock dataset. | A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets. | WBPaper00031003:hlh_1_enriched |
Transcripts that showed significantly increased expression in spr-1(ok2144) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:spr-1(ok2144)_upregulated | |
Single-cell RNA-Seq cell group 30_0 expressed in valve. | scVI 0.6.0 | WBPaper00065841:30_0 | |
Transcripts that showed significantly increased expression in emb-4(hc60) comparing to in N2. | DESeq2 | WBPaper00052884:emb-4(hc60)_upregulated |
22 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Expr1031768 | Tiling arrays expression graphs | |||
Also expressed in (comments from author) : No comment. Strain: BC11887 | [nob-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCTGCTTATCGATTTTTCTGA] 3' and primer B 5' [CATCACCGAAATGATTCCATA] 3'. | Expr7127 | Adult Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; Larval Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; head neurons; | |
Clone: pUL#JRHB12 | Expr7744 | Expression from late embryo to adult. Complex expression in late embryo. Dorsal nerve cord, ventral nerve cord and two head nerves lateral to posterior pharyngeal bulb. Also two nerves in tail (possibly phasmids). Possibly artifactual expression in head muscles and intestine. | ||
Expr7323 | Click the movie links below for interactive 4D movies of a fluorescence reporter. http://glowormnotes.blogspot.com/2009/11/nob-1yfp-transcriptional-fusion.html | |||
Expr13013 | nob-1 is strongly expressed in the linker cell nucleus from the L3 larval stage onward. NOB-1 is thought to function as a posterior Hox gene, and is expressed in many tail cell nuclei. | |||
Expr10399 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
Expr16261 | We found that an endogenous php-3::GFP knock-in we created via CRISPR/Cas9-mediated gene editing was expressed in DVA, DVC, PVR, PHCL/R, and PLNL/ R neurons, whereas a translational reporter stIs10286[nob-1::GFP] was expressed only in DVA, PHCL/R, and PLNL/R neurons, suggesting that php-3 and nob-1 may have slightly different expression patterns. Neither php-3 nor nob-1 was expressed in the ventral nerve cord. | |||
Expr15632 | ||||
Expr11063 | A nob-1::gfp translational fusion construct (containing a genomic fragment with the nob-1 gene and 9 Kb of the 5'-regulatory region) is expressed in the tail tip cells hyp8-11 throughout larval development in both sexes. | |||
Expr12588 | The posterior Hox gene nob-1 is expressed in PLM but not ALM. | |||
Original chronogram file: chronogram.1590.xml | [Y75B8A.2:gfp] transcriptional fusion. | Chronogram568 | ||
Expr10397 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
Expr10398 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
Expr1170074 | Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191 | |||
Expr10514 | Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
Expr1170076 | Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191 | |||
Expr10515 | Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
Expr1161865 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
Expr10400 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
Expr1018082 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
Expr2014345 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Expr2032586 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). |
17 GO Annotation
Annotation Extension | Qualifier |
---|---|
enables | |
enables | |
enables | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
occurs in(WBbt:0004944)|occurs in(WBbt:0004946) | involved_in |
involved_in | |
enables | |
involved_in | |
located_in | |
located_in | |
involved_in | |
located_in | |
involved_in | |
involved_in |
17 Ontology Annotations
Annotation Extension | Qualifier |
---|---|
enables | |
enables | |
enables | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
occurs in(WBbt:0004944)|occurs in(WBbt:0004946) | involved_in |
involved_in | |
enables | |
involved_in | |
located_in | |
located_in | |
involved_in | |
located_in | |
involved_in | |
involved_in |
1 Upstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrIII_12084317..12098750 | 14434 | III: 12084317-12098750 | Caenorhabditis elegans |