WormMine: Gene WBGene00003929

• WormBase Gene ID: WBGene00003929
• Gene Name: pat-2
• Sequence Name: F54F2.1
• Brief Description: pat-2 encodes an alpha integrin subunit; during embryogenesis, pat-2 is essential for body wall muscle assembly and function and hence, proper elongation and hatching.
• Organism: Caenorhabditis elegans
• Automated Description: Enables transmembrane signaling receptor activity. Involved in several processes, including muscle cell cellular homeostasis; positive regulation of cellular component organization; and regulation of locomotion. Located in M band; cell surface; and striated muscle dense body. Expressed in body wall musculature; distal tip cell; hypodermis; and touch receptor neurons. Human ortholog(s) of this gene implicated in several diseases, including abdominal aortic aneurysm; blood platelet disease (multiple); and von Willebrand's disease (multiple). Is an ortholog of several human genes including ITGA2B (integrin subunit alpha 2b); ITGA5 (integrin subunit alpha 5); and ITGAV (integrin subunit alpha V).
• Biotype: SO:0001217
• Genetic Position: III :-0.048404 ±0.001316
• Length (nt): 6368

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003929

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F54F2.1.1	F54F2.1.1	3972	III: 8818899-8825266

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F54F2.1	F54F2.1	3681	III: 8818902-8819074

45 RNAi Result

• WBRNAi00110196
• WBRNAi00063786
• WBRNAi00048363
• WBRNAi00008859
• WBRNAi00075645
• WBRNAi00109189
• WBRNAi00116133
• WBRNAi00064610
• WBRNAi00092226
• WBRNAi00091712
• WBRNAi00091780
• WBRNAi00091779
• WBRNAi00071701
• WBRNAi00091727
• WBRNAi00086110
• WBRNAi00113864
• WBRNAi00109287
• WBRNAi00068639
• WBRNAi00091667
• WBRNAi00086112
• WBRNAi00068638
• WBRNAi00086111
• WBRNAi00113865
• WBRNAi00109481
• WBRNAi00068641
• WBRNAi00113868
• WBRNAi00068640
• WBRNAi00064765
• WBRNAi00069027
• WBRNAi00069026

65 Allele

• gk964518
• gk963887
• otn9813
• gk315483
• gk443138
• gk692983
• gk477174
• gk647679
• gk588029
• gk809091
• gk389029
• gk446370
• gk832812
• gk647680
• gk628855
• gk667689
• gk870873
• gk409377
• gk312182
• gk876073
• gk428196
• gk574991
• gk416615
• gk326740
• gk830823
• gk580642
• gk687567
• gk663836
• ok2148
• WBVar01990287

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003929
• Start: 8818899
• End: 8825266
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

190 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Photorhabdus luminescens	Genes down-regulated in animals infected with Photorhabdus luminescens compared to the E. coli OP50 control after 24h of infection.	MAANOVA and BRB-Array-Tools.	WBPaper00030985:Photorhabdus_luminescens_downregulated
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated

16 Expression Patterns

• Primary Identifier: Expr4872
• Remark: Picture: Figure 2. Similar DTC expression of GFP was observed in two other independently derived 6-kb pat-2 promoter fusion lines as well as with shorter promoter fusions of 3, 2, and <0.5 kb of pat-2 upstream sequence. To verify that this pattern is an accurate representation of PAT-2 expression, a translational fusion line with GFP inserted near the end of the cytoplasmic tail was examined. The PAT-2::GFP expression pattern was the same as the transcriptional fusions, including the up-regulation of expression in the DTC during L3.
• Pattern: In each line, the pat-2p::GFP nematodes had high levels of GFP expression in body-wall muscle cells and vulval tissue. No GFP was detected in the DTCs migrating on the ventral ECM during L2. GFP was visible in DTCs during L3, when the DTC migrates from the ventral to dorsal surface, and was maintained in the DTC throughout adulthood.

• Primary Identifier: Expr4303
• Pattern: Detected primarily in neurons.

• Primary Identifier: Expr1031862
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6182
• Remark: Strain: BC13769
• Reporter Gene: [F54F2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCAACTTTCCGTTTTCTCTTCT] 3' and primer B 5' [AACTACCCTCTCGGATCTACTGG] 3'.
• Pattern: Adult Expression: Reproductive System; uterine muscle; vulval muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; phasmids; Larval Expression: Reproductive System; developing vulva; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; phasmids

• Primary Identifier: Expr6183
• Remark: Strain: BC15338
• Reporter Gene: [F54F2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCAACTTTCCGTTTTCTCTTCT] 3' and primer B 5' [AACTACCCTCTCGGATCTACTGG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: Reproductive System; developing vulva; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr11780
• Pattern: pat-2p::gfp is expressed in ALM, AVM, and PLM touch receptor neurons.

• Primary Identifier: Expr11781
• Pattern: unc-112p::unc-112::gfp is expressed in ALM, AVM, and PLM touch receptor neurons.

• Primary Identifier: Expr8768
• Remark: Picture: Fig S2C.
• Pattern: Full-length PAT-2::GFP transgene is not expressed in the AC at the time of invasion.

• Primary Identifier: Expr10025
• Pattern: PAT- 2::GFP or PAT-2::mCherry was found to be expressed in body wall muscles and hypodermal cells during embryogenesis. Notably, a strong GFP signal was observed along the surface of apoptotic cells adjacent to muscle cells, whereas a relatively weak GFP signal was seen around apoptotic cells engulfed by hypodermal cells.
• Subcellular Localization: PAT-2::mCherry and PAT- 3::GFP were co-localized on apoptotic cells and to the dense bodies (Z-disks) and M-lines of muscle cells.

• Primary Identifier: Expr1152157
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1024503
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr11787
• Pattern: At initiation of migration, DTCs express PAT-3.

• Primary Identifier: Expr14844
• Subcellular Localization: Endogenously tagged INA-1:: mNG, PAT-2::2XmNG, and PAT-3::mNG were expressed in the gonad and pharyngeal cells and localized to the cell-BM interface.

• Primary Identifier: Chronogram1587
• Remark: Original chronogram file: chronogram.469.xml
• Reporter Gene: [F54F2.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2032984
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2014750
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

28 GO Annotation

50 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003929
• Start: 8818899
• End: 8825266
• Strand: 1

28 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 6368

1 Sequence Ontology Term

• Name: gene

9 Strains

• WBStrain00022228
• WBStrain00022229
• WBStrain00022230
• WBStrain00022231
• WBStrain00022232
• WBStrain00033506
• WBStrain00033503
• WBStrain00037261
• WBStrain00047392

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_8811288..8818898
• Length (nt): 7611
• Chromosome Location: III: 8811288-8818898
• Organism: Caenorhabditis elegans