WormMine: Gene WBGene00004006

• WormBase Gene ID: WBGene00004006
• Gene Name: pgp-12
• Sequence Name: F22E10.1
• Brief Description: pgp-12 encodes a transmembrane protein that is a member of the P-glycoprotein subclass of ATP-binding cassette (ABC) transporters; pgp-12 promoter fusion constructs reveal expression in the excretory cell, consistent with a role for pgp-12 in metabolite transporter activity; pgp-12 expression is regulated by the DCP-66 transcription factor which binds the pgp-12 Ex-1 promoter element in yeast one-hybrid and EMSA experiments.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ATPase-coupled transmembrane transporter activity. Involved in response to nematicide. Predicted to be located in membrane. Expressed in head and tail. Human ortholog(s) of this gene implicated in several diseases, including autoimmune disease (multiple); carcinoma (multiple); and intrahepatic cholestasis (multiple). Is an ortholog of several human genes including ABCB1 (ATP binding cassette subfamily B member 1); ABCB11 (ATP binding cassette subfamily B member 11); and ABCB4 (ATP binding cassette subfamily B member 4).
• Biotype: SO:0001217
• Genetic Position: X :8.15136 ±0.016185
• Length (nt): 5635

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004006

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F22E10.1.1	F22E10.1.1	4137	X: 12731807-12737441

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F22E10.1	F22E10.1	3957	X: 12731850-12731927

3 RNAi Result

• WBRNAi00045322
• WBRNAi00013751
• WBRNAi00066529

92 Allele

• gk964260
• gk964029
• gk962707
• gk964028
• gk963810
• WBVar01759681
• gk297065
• gk297066
• gk297068
• gk297067
• gk297072
• gk297071
• gk297070
• gk297069
• gk297076
• gk297075
• gk297074
• gk297073
• gk297079
• gk297078
• gk297077
• WBVar01711144
• gk658691
• gk689513
• gk387703
• gk387702
• cxTi2523
• gk595404
• gk795075
• gk585553

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004006
• Start: 12731807
• End: 12737441
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

141 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults.	Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05.	WBPaper00061530:nhr-49(e2144)_downregulated
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Transcripts that showed significantly increased expression in adr-1(tm668) and adr-1(gv6) comparing to in N2 at embryo stage.	DESeq FDR <= 0.05	WBPaper00056617:adr-1_upregulated_embryo_transcript
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in wdr-5(ok1417);skn-1(lax188) comparing to in skn-1(lax188) at day 2 adult stage.	fold change > 2	WBPaper00058711:wdr-5(ok1417)_upregulated
Reduced humidity (98% relative humidity).	Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis.	Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001.	WBPaper00044578:reduced-humidity_downregulated_microarray
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in mut-16(pk710), comparing to in N2 animals.	DESeq2 v. 1.22.2, adjusted p-value <= 0.05.	WBPaper00059605:mut-16(pk710)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.05.	WBPaper00066608:npr-15(tm12539)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Student's t-test, fold change > 2, p-value < 0.05.	WBPaper00055386:daf-2(e1370)_upregulated

15 Expression Patterns

• Primary Identifier: Expr4611
• Pattern: Expressed in: excretory cell.

• Primary Identifier: Expr4612
• Remark: Species: C. briggsae.
• Pattern: In C. briggsae, the gene expressed in: excretory cell.

• Primary Identifier: Expr5825
• Remark: Strain: BC10089
• Reporter Gene: [pgp-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCTTGCAGTGAACCAGAA] 3' and primer B 5' [TTACGCCACTTGATGTTTAACCTA] 3'.
• Pattern: Adult Expression: excretory cell; Larval Expression: excretory cell

• Primary Identifier: Expr5826
• Remark: Strain: BC11430
• Reporter Gene: [pgp-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCTTGCAGTGAACCAGAA] 3' and primer B 5' [TTACGCCACTTGATGTTTAACCTA] 3'.
• Pattern: Adult Expression: excretory cell; Larval Expression: excretory cell

• Primary Identifier: Expr5827
• Remark: Also expressed in (comments from author) : unidentified cells in head and tail Strain: BC10210
• Reporter Gene: [pgp-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCTTGCAGTGAACCAGAA] 3' and primer B 5' [TTACGCCACTTGATGTTTAACCTA] 3'.
• Pattern: Adult Expression: pharynx; hypodermis; excretory cell; unidentified cells in head; unidentified cells in tail ; Embryo Expression: intestine; excretory cell; Larval Expression: pharynx; excretory cell; unidentified cells in head

• Primary Identifier: Expr3778
• Remark: Reporter gene fusion type not specified. The dual reporter genes were used to exclude the possibility that the resulting expression was the artifact of reporter rather than the result of the promoter used.
• Pattern: The promoter drove both GFP and DsRed expression exclusively in the excretory cell at all developmental stages.

• Primary Identifier: Expr3322
• Pattern: Expressed excretory cell at all stages, 8 isolates.

• Primary Identifier: Expr3323
• Pattern: Expressed in excretory cell at all stages, 3 isolates.

• Primary Identifier: Expr2014865
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1027794
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1987
• Remark: Original chronogram file: chronogram.901.xml
• Reporter Gene: [F22E10.1:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1222
• Remark: Original chronogram file: chronogram.2345.xml
• Reporter Gene: [F22E10.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2033100
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1149246
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1526
• Remark: Original chronogram file: chronogram.40.xml
• Reporter Gene: [F22E10.1:gfp] transcriptional fusion.

12 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004006
• Start: 12731807
• End: 12737441
• Strand: 1

12 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5635

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00035488
• WBStrain00001227
• WBStrain00001161

0 Upstream Intergenic Region