WormMine: Gene WBGene00005049

• WormBase Gene ID: WBGene00005049
• Gene Name: sra-23
• Sequence Name: T06G6.1
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway and sensory perception of chemical stimulus. Predicted to be located in membrane. Expressed in PQR; head; and neurons.
• Biotype: SO:0001217
• Genetic Position: I :13.949 ±0.000985
• Length (nt): 1293

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00005049

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T06G6.1.1	T06G6.1.1	1023	I: 12703435-12704727

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T06G6.1	T06G6.1	1023	I: 12703435-12703689

2 RNAi Result

• WBRNAi00052679
• WBRNAi00004149

42 Allele

• gk963849
• gk964175
• gk963095
• WBVar01433973
• WBVar01433974
• WBVar01433975
• gk931942
• WBVar00101573
• gk571238
• gk450307
• gk617681
• gk528628
• gk929
• gk125535
• WBVar01427148
• WBVar02056714
• WBVar02056713
• gk125534
• tm11673
• gk125533
• WBVar01288368
• WBVar01850260
• WBVar01850259
• WBVar01850258
• WBVar01850257
• gk963508
• WBVar01850262
• WBVar01850261
• WBVar01850252
• WBVar01850251

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00005049
• Start: 12703435
• End: 12704727
• Strand: 1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_12704728..12705096
• Length (nt): 369
• Chromosome Location: I: 12704728-12705096
• Organism: Caenorhabditis elegans

7 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:sre-33-ZK1025.1_8337
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_18
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:intestine_L2-larva_expressed
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Germline-intrinsic transcripts.	Comparisons were made between genotypes by subtracting the mean log value of one ratio from another, and the significance of the difference was evaluated using Student t-test for two populations. For the fem-3(gf) versus fem-1(lf) direct comparison, authors performed the same analysis, except they used a Students t-test for one population. Author chose a combination of a twofold difference with a t value exceeding 99% confidence (P < 0.01), because these criteria allowed the inclusion of essentially all genes that had previously been identified as germline-enriched in a wt/glp-4 hermaphrodite comparison. Additionally, requiring a twofold difference reduced false positives, as the number of genes with two-fold difference and a P<0.01 only included ~100 genes more than with P < 0.001, and almost all genes showed germline expression by in situ hybridization.	[cgc6390]:intrinsic
Space flight.	Genes increased by more than 2 fold expression in the spaceflight relative to the ground control.	Genes increased by more than 2 fold expression in the spaceflight relative to the ground control are regarded as differentially expressed.	WBPaper00041267:SpaceFlight_Upregulated

7 Expression Patterns

• Primary Identifier: Expr2034371
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6623
• Remark: Strain: BC13491
• Reporter Gene: [sra-23::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACAGAAGGCGAGGCAAGAC] 3' and primer B 5' [AAAACGGAAGAAAAAGCGTTC] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; tail neurons; Larval Expression: intestine; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr6624
• Remark: Also expressed in (comments from author) : 2 low intensity GFP cells in the head. Strain: BC12001
• Reporter Gene: [sra-23::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACAGAAGGCGAGGCAAGAC] 3' and primer B 5' [AAAACGGAAGAAAAAGCGTTC] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; unidentified cells in head; Larval Expression: intestine; Nervous System; head neurons; unidentified cells in head

• Primary Identifier: Expr14004
• Pattern: ASI, AWB, 2 single midline neurons - one dorsal (on top of ASKs) and one ventral (anterior to ASJ), PQR

• Primary Identifier: Expr1024383
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1156285
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1427
• Remark: Original chronogram file: chronogram.306.xml
• Reporter Gene: [T06G6.1:gfp] transcriptional fusion.

6 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00005049
• Start: 12703435
• End: 12704727
• Strand: 1

6 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1293

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00002614
• WBStrain00001980

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_12702887..12703434
• Length (nt): 548
• Chromosome Location: I: 12702887-12703434
• Organism: Caenorhabditis elegans