WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005545 Gene Name  sri-33
Sequence Name  ? Y27F2A.4 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Biotype  SO:0001217
Genetic Position  II :-8.17322 ±0.010969 Length (nt)  ? 2292
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005545

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:Y27F2A.4.1 Y27F2A.4.1 1011   II: 3154558-3156849
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:Y27F2A.4 Y27F2A.4 1011   II: 3154558-3154620

1 RNAi Result

WormBase ID
WBRNAi00055757

84 Allele

Public Name
gk964317
gk963801
WBVar02122780
WBVar02124390
WBVar02122098
WBVar02122355
gk962754
WBVar02124872
WBVar02121545
WBVar02120617
WBVar02121721
WBVar02120928
h10563
gk963671
WBVar02124329
WBVar02122217
WBVar02123184
tm11318
WBVar02122301
WBVar02124160
WBVar02120454
WBVar02123658
WBVar02120784
WBVar02121368
WBVar02123359
WBVar02122913
WBVar01695195
WBVar01695196
WBVar01436860
WBVar02029027

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005545 3154558 3156849 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_3154484..3154557   74 II: 3154484-3154557 Caenorhabditis elegans

25 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
  Genes up regulated by Tryptophan. Differentially expressed genes had a fold change cutoff of 2.0 and an unpaired t test p value cutoff of 0.05 for WT+Trp versus WT and 0.01 for nhr-114 versus glp-1. WBPaper00042194:Tryptophan_upregulated
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
  Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. SAM algorithm with an FDR < 0.1. WBPaper00033065:clk-1(qm30)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:germline-precursors_blastula-embryo_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_L2-larva_expressed
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L1-larva_expressed
  Transcripts down regulated in hpl-2(tm1489) embryo comparing to N2 in tiling array analysis. Oligos from the tiling array were mapped to chromosome coordinates of the exons from Wormbase WS180. Any oligo that mapped to a gene on both the Watson and Crick strands was excluded. The remaining oligos were then grouped together (perfect match and mismatch) into probe sets and written out into an Affymetrix CDF file. The CDF file was converted into an R-package and loaded into R. The expression values were calculated using the justRMA function from Bioconductor. This used a Benjamini and Hochberg false discovery rate correction. WBPaper00040560:hpl-2_embryo_downregulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:GABAergic-motor-neurons_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:pharyngeal-muscle_L1-larva_expressed
  Genes that showed significantly increased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control. Fold change > 1.2 or < 0.8. WBPaper00042477:rsr-2(RNAi)_upregulated_TilingArray
Fungi infection: Fusarium oxysporum Transcripts that showed significantly altered expression after infected by fungi Fusarium oxysporum from 0 t0 48 hours. The Benjamini and Hochberg approach was used to adjust the resulting P-values for controlling the false-discovery rate. The transcripts having a false-discovery rate of < 0.05 were considered as differentially expressed. WBPaper00053368:F.oxysporum_regulated
  Transcripts that showed significantly increased expression in FACS sorted neuron cells (labelled by pan-neuronal GFP) from edIs6[unc-119::GFP + rol-6(su1006)]; thoc-5(wy822) comparing to in edIs6. DESeq2, log2 fold change > 2, adjusted p-value < 0.005. WBPaper00055103:thoc-5(wy822)_upregulated
  Coexpression clique No. 282, srj-21-srh-32, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-21-srh-32
  Genes predicted to be downregulated more than 2.0 fold in rde-3(r459) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rde-3(r459)_downregulated
  Genes predicted to be downregulated more than 2.0 fold in rrf-1(pk1417) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rrf-1(pk1417)_downregulated

4 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1019646 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Also expressed in (comments from author) : No comments. Strain: BC15967 [sri-33::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAGACCAAAACGCCTCT] 3' and primer B 5' [AAAATGTTAAGGCTCAATTCTCAA] 3'. Expr6915 Adult Expression: Nervous System; head neurons; amphids; Larval Expression: Nervous System; head neurons; amphids;  
    Expr2016544 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1159288 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005545 3154558 3156849 -1

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
2292

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00003688

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_3156850..3157264   415 II: 3156850-3157264 Caenorhabditis elegans