WormMine: Gene WBGene00005643

• WormBase Gene ID: WBGene00005643
• Gene Name: srp-2
• Sequence Name: C05E4.1
• Brief Description: srp-2 encodes an ovalbumin-like serpin (ov-serpin), that is a member of the serine protease inhibitor superfamily; SRP-2 is predicted to function as a suicide substrate that inhibits the proteolytic activity of serine proteases, and in vitro, recombinant SRP-2 is able to inhibit granzyme B activity; srp-2 expression is detected in hypodermal cells, particularly in the lateral seam cells.
• Organism: Caenorhabditis elegans
• Automated Description: Enables cysteine-type endopeptidase inhibitor activity and serine-type endopeptidase inhibitor activity. Predicted to be located in extracellular space. Expressed in several structures, including anal sphincter muscle; cuticle; epithelial cell; intestine; and phasmid neurons. Used to study familial encephalopathy with neuroserpin inclusion bodies. Human ortholog(s) of this gene implicated in several diseases, including Alzheimer's disease; artery disease (multiple); eye disease (multiple); and lung disease (multiple). Is an ortholog of human SERPINI1 (serpin family I member 1) and SERPINI2 (serpin family I member 2).
• Biotype: SO:0001217
• Genetic Position: V :-19.954±
• Length (nt): 1957

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00005643

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C05E4.1.2	C05E4.1.2	1294	V: 762640-764596
Transcript:C05E4.1.1	C05E4.1.1	1161	V: 762817-764590

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C05E4.1	C05E4.1	1080	V: 762854-762870

5 RNAi Result

• WBRNAi00000607
• WBRNAi00039776
• WBRNAi00010226
• WBRNAi00088978
• WBRNAi00114476

54 Allele

• WBVar01584342
• gk963591
• gk963553
• gk964259
• gk963850
• gk963027
• gk963889
• gk962552
• gk962551
• tm744
• WBVar01609803
• WBVar01609802
• WBVar00201885
• WBVar00201884
• WBVar00201887
• WBVar00201886
• WBVar00201888
• WBVar01689312
• WBVar00580311
• WBVar01689313
• WBVar00580313
• WBVar00580314
• ok350
• WBVar00580316
• gk225241
• gk225242
• gk225239
• gk225240
• gk225238
• gk225243

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00005643
• Start: 762640
• End: 764596
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_764597..765031
• Length (nt): 435
• Chromosome Location: V: 764597-765031
• Organism: Caenorhabditis elegans

206 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Genes that were upregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly decreased expression in adbp-1(qj1) comparing to in N2 animals at L4 larva stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00067079:adbp-1(qj1)_downregulated_L4
Bacteria diet: Comamonas aquatica DA1887 vs. E. coli OP50	Transcripts that showed significantly decreased expression in N2 L3 larva animals fed with Comamonas aquatica strain DA1887, comparing to in N2 L3 larva animals fed with E. coli OP50.	edgeR, fold change > 2, p-value < 0.05.	WBPaper00067248:C.aquatica_downregulated_L3
	Transcripts that showed significantly decreased expression in skn-1gf(lax188) comparing to in N2 animals at L4 stage fed with OP50 and exposed to PA14 for 4 hours.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00067255:skn-1(lax188)_downregulated_PA
starvation 12 hours	Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals.	EdgeR, FDR < 0.05, fold change >= 2.	WBPaper00067259:starvation_upregulated_intestine
	Transcripts that showed significantly increased expression in enriched nuclei of daf-2(e1370) comparing to in wild type nuclei.	edgeR, fold change > 2, FDR < 0.05	WBPaper00067267:daf-2(e1370)_upregulated_nuclei
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in miR-80(nDf53) comparing to in N2.	EdgeR fold change > 2, FDR < 0.05.	WBPaper00067295:miR-80(nDf53)_downregulated
	Transcripts that showed significantly increased expression in nhr-114(gk849) comparing to wild type animals at L4 larva.	DESeq2 1.26.0, fold change > 2, FDR < 0.05.	WBPaper00064539:nhr-114(gk849)_upregulated
	Transcripts that showed significantly increased expression at the intestine cells of daf-2(e1370) comparing to the intestine cells of N2 animals at L2 larva stage.	DESeq2 (version 1.24.0), fold change >= 2, FDR < 0.05	WBPaper00064632:daf-2(e1370)_upregulated_intestine
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed signifcantly increased expression in pabp-2(RNAi) animals comparing to in N2 animals injected with empty vector at L1 larva stage and collected at L4 larva stage.	FDR < 0.05, fold change > 2	WBPaper00067368:pabp-2(RNAi)_upregulated_N2
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in eat-2(ad465);atfs-1(RNAi) animals comparing to eat-2(ad465) animals injected with empty vector.	fold change > 2, FDR < 0.01	WBPaper00067391:atfs-1(RNAi)_upregulated_eat-2(ad465)
Heat Shock: 35C 4 hours at L4 larva stage.	Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours	DESeq2	WBPaper00057154:HeatShock_downregulated_mRNA
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated

11 Expression Patterns

• Primary Identifier: Expr5178
• Remark: Strain: BC15183
• Reporter Gene: [srp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCTTGGTTTTGAAATTTTGG] 3' and primer B 5' [CGGACATTGTCGGAAAATTATG] 3'.
• Pattern: Adult Expression: hypodermis; Larval Expression: hypodermis; amphid socket cells

• Primary Identifier: Expr2034795
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr53
• Remark: Fusion junction ...CCCAATTTAAAGTTTTCCAAACATGTTTCAGCCAAGCCAATACCATTCACCAGGATTACCTTGAAACCG TTGAAAAATTATACAAAGCTTCGGGTGAAAGCCTCGATTTTTCTCAGACCGAACAAGCGGCAAAGGTGCATC ATGCTCGCCCGTTTTCCATAATATTCCACTTTCAGACCATGAACACCTTTGTGGAAAATCATACAAATGGAA AGATC/lacZ This Expression pattern was attached to a sequence (C05E4.k) which has been replaced with a numbered suffix the details of which were temporarily lost. However, we now believe that .k became C05E4.1. Other authors: Author "Arnold JM" "Herbert R" "Hope IA"Date 1993-01.
• Pattern: Nuclear localised expression in a restricted subset of hypodermal cells. A strain generated with a pool of plasmids gave expression in the anterior and posterior seam cells only.

• Primary Identifier: Expr1032521
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2933
• Pattern: SRP-2 expression is evident in numerous cells of the C. elegans embryo in the early stages of development (36-100-cell stage). However, in the later stages of embryonic development, expression is confined to a few cells of the anterior hypoderm and the eggshell. In the L1 and L2 larvae, expression is seen in a number of hypodermal (possibly hyp 1, 2, and 3) cells near the buccal cavity. Expression is also seen in the sensory support (sheath or socket) cells of several sensilla. Strong expression is visible in the posterior intestinal cells, seam cells, and the body hypoderm. In the adult hermaphrodite, strong punctate expression is seen in the hypodermal cells surrounding the anterior and posterior bulb of the pharynx. Expression was also seen in hyp 7 cells near the vulval opening. A strong striated staining pattern was seen in what appears to be the fibrous organelles that link muscle/hypoderm/cuticle. GFP expression was also observed in the phasmid (PHA and PHB) neurons, which was confirmed by co-staining with the amphid neuron-specific dye, DiI. The overall SRP-2::GFP expression pattern was similar in the hermaphrodites and males.

• Primary Identifier: Expr11669
• Subcellular Localization: Wild-type SRP-2 co-localized with actin-myosin filaments in body wall musculature.

• Primary Identifier: Chronogram261
• Remark: Original chronogram file: chronogram.1287.xml
• Reporter Gene: [C05E4.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1012729
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1143862
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2016603
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr12534
• Subcellular Localization: GFP-tagged wild-type SRP-2 localizes to the cytosol and not the endoplasmic reticulum.

5 GO Annotation

144 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00005643
• Start: 762640
• End: 764596
• Strand: 1

5 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1957

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00031378
• WBStrain00003393

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_761983..762639
• Length (nt): 657
• Chromosome Location: V: 761983-762639
• Organism: Caenorhabditis elegans