WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00006541 Gene Name  tbh-1
Sequence Name  ? H13N06.6 Brief Description  tbh-1 encodes a tyramine beta-hydroxylase orthologous to human DBH (OMIM:609312, mutated in dopamine beta-hydroxylase deficiency); TBH-1 activity is required for biosynthesis of the octopamine neurotransmitter.
Organism  Caenorhabditis elegans Automated Description  Enables tyramine-beta hydroxylase activity. Involved in octopamine biosynthetic process. Located in synapse. Expressed in RICL; RICR; and gonad. Human ortholog(s) of this gene implicated in several diseases, including alcohol use disorder; attention deficit hyperactivity disorder; and dopamine beta-hydroxylase deficiency. Is an ortholog of human DBH (dopamine beta-hydroxylase).
Biotype  SO:0001217 Genetic Position  X :22.7341 ±0.010816
Length (nt)  ? 4640
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00006541

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:H13N06.6a.1 H13N06.6a.1 1869   X: 15500256-15503396
Transcript:H13N06.6b.1 H13N06.6b.1 2068   X: 15500260-15504522
Transcript:H13N06.6c.1 H13N06.6c.1 2012   X: 15500263-15504895
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:H13N06.6b H13N06.6b 1974   X: 15500354-15500633
CDS:H13N06.6c H13N06.6c 1821   X: 15500354-15500633
CDS:H13N06.6a H13N06.6a 1758   X: 15500354-15500633

2 RNAi Result

WormBase ID
WBRNAi00049396
WBRNAi00016264

99 Allele

Public Name
gk964260
gk962707
gk963810
gk963581
gk963194
gk734025
WBVar01553452
WBVar01553451
WBVar01553450
WBVar01553449
WBVar01553448
gk613475
WBVar01553447
gk350348
WBVar01553446
gk680730
WBVar01946576
gk610645
WBVar01946575
gk449222
gk475929
gk801773
gk489931
gk677140
gk560947
gk893668
gk449933
WBVar02102466
WBVar01897973
gk303546

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00006541 15500256 15504895 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

256 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  oocyte proteins identified by two or more unique peptides during proteomics study. In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. WBPaper00038289:oocyte_protein
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_N2
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_aging
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
  Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Escherichia coli HB101. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage. EdgeR, fold change > 2, FDR < 0.001. WBPaper00056290:hsp-6(mg585)_downregulated
  Transcripts that showed significantly decreased expression in mdt-15(mg584gf) comparing to in N2 at L4 larva stage. EdgeR, fold change > 2, FDR < 0.001. WBPaper00056290:mdt-15(mg584)_downregulated
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
Dietary restriction Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition. Bioconductor package edgeR, p < 0.05. WBPaper00056443:DietaryRestriction_downregulated
  Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). CuffDiff2 WBPaper00051265:F4_hrde-1(tm1200)_upregulated
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage. DEseq2, fold change > 2 WBPaper00064505:tamoxifen_upregulated
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated

9 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2035480 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12162 [tbh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCACCCTCTCCTTCTTGATGTT] 3' and primer B 5' [CAACGGCACTTCTGATTTTTC] 3'. Expr6276 Adult Expression: intestine; rectal gland cells; Reproductive System; spermatheca; gonad sheath cells; Nervous System; head neurons; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons;  
No staining was observed in tbh-1(n3247) mutants.   Expr3721 C. elegans whole-mount staining with TBH-1 antibodies labeled a single pair of head interneurons in the lateral ganglion: these neurons were identified as the RICs. Punctate TBH-1 staining was also observed in the gonadal sheath cells of adult hermaphrodites. TBH-1 staining was most prominent in the proximal three pairs of sheath cells, which form a contractile myoepithelium that expels oocytes from the gonad during ovulation. Bright staining was observed in RIC synaptic regions, as indicated by a punctate immunofluorescence pattern in the nerve ring, whereas weaker staining was observed in the RIC neuronal processes and cell bodies. By contrast, TBH-1 staining was predominantly localized to the RIC cell bodies of mutants defective in the unc-104 gene, which encodes a neuron-specific kinesin required for the anterograde transport of synaptic vesicles. TBH-1, like the closely related dopamine B-hydroxylase, probably is associated with synaptic vesicles.
    Expr16043 In C. elegans, consistent with a previous report, OA synthetic enzymes are highly expressed in the spermatheca and the proximal gonadal sheath. tbh-1 expression in the gonadal sheath begins from the late larval stage 4 (L4), when diplotene-stage oocytes appear, while tbh-1 expression in RIC interneurons in the head begins as early as at the L1 stage. This tbh-1 expression in gonadal sheath cells accounts for the observation that adult C. elegans produce at least five times more OA than larvae, which express OA only in RIC29. The level of TBH-1 is the strongest in the proximal three pairs of gonadal sheath cells, which cover the meiotic oocytes in- waiting, suggesting a potential OA function in oocyte quiescence. Strong expression in the spermatheca, which are involved in fertilizing and moving the fertilized eggs, suggests a role of OA in ovulation, as has been reported in D. melanogaster.  
Picture: Supplemental Figure S1.   Expr8276 GFP expression was observed in RIC neurons and gonadal sheath cell.  
Curated by authors based on online in-situ hybridization database (Y. Kohara, personal communication; http://nematode.lab.nig.ac.jp).   Expr4165 Expressed in somatic gonad.  
    Expr1153129 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1023515 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2017344 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

19 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  located_in

9 Homologues

Type
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00006541 15500256 15504895 -1

19 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  located_in

2 Regulates Expr Cluster

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly decreased expression in tbh-1(ok1196);odIs77 comparing to in odIs77 control animals. EdgeR, FDR<0.01 WBPaper00060921:tbh-1(ok1196)_downregulated
  Transcripts that showed significantly increased expression in tbh-1(ok1196);odIs77 comparing to in odIs77 control animals. EdgeR, FDR<0.01 WBPaper00060921:tbh-1(ok1196)_upregulated

1 Sequence

Length
4640

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00027363
WBStrain00031863

0 Upstream Intergenic Region