Genomics
3 Transcripts
Class | WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|---|
MRNA | Transcript:R151.5a.2 | R151.5a.2 |
2079
![]() |
III: 7202206-7207664 |
MRNA | Transcript:R151.5a.1 | R151.5a.1 |
2015
![]() |
III: 7202661-7207664 |
NcPrimaryTranscript | Transcript:R151.5b | R151.5b |
1672
![]() |
III: 7202662-7207429 |
Other
1 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:R151.5a | R151.5a |
1779
![]() |
III: 7202662-7202865 |
80 Allele
Public Name |
---|
gk964518 |
gk963887 |
gk350439 |
gk356840 |
gk416884 |
gk417872 |
gk366784 |
gk415964 |
gk178021 |
gk362314 |
gk371185 |
gk309783 |
gk309784 |
e2770 |
WBVar01656985 |
WBVar01656987 |
WBVar01656986 |
gk509615 |
gk579977 |
gk766647 |
gk505997 |
gk873526 |
gk589892 |
gk646699 |
gk595602 |
gk475616 |
gk424220 |
gk759133 |
WBVar01837783 |
gk748048 |
1 Chromosome Location
Feature . Primary Identifier |
Start | End | Strand |
---|---|---|---|
WBGene00006592 | 7202206 | 7207664 | 1 |
4 Data Sets
Name | URL |
---|---|
WormBaseAcedbConverter | |
GO Annotation data set | |
C. elegans genomic annotations (GFF3 Gene) | |
Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrIII_7207665..7208446 | 782 | III: 7207665-7208446 | Caenorhabditis elegans |
182 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Genes with expression altered >= 3-fold in dpy-10(e128) mutants. | Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). | WBPaper00035873:dpy-10_regulated | |
Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. | SAM | WBPaper00031040:TGF-beta_adult_upregulated | |
Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). | DESeq2, fold change >= 2, FDR <= 0.01. | WBPaper00056826:SGP_biased | |
Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day5_vs_Day1_downregulated | |
Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2. | DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1. | WBPaper00046012:tdp-1(ok803)_upregulated | |
Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day11_vs_Day1_downregulated | |
Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. | edgeR, fold change > 2, FDR < 0.05 | WBPaper00060909:atfs-1(cmh15)_downregulated | |
Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
mitochondrial sulfide delivery molecule (mtH2S) AP39 | Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11 |
Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background | |
Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_N2-background | |
Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. | DESeq2 version 1.22.2, p < 0.05 | WBPaper00064716:paraquat_downregulated | |
Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals. | NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%. | WBPaper00064727:daf-2(e1370)_upregulated | |
Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. | SAM algorithm with an FDR < 0.1. | WBPaper00033065:clk-1(qm30)_upregulated | |
Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated | |
Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh6), triggered by the dafachronic acid (DA) growth hormone. Cluster 3 genes increased expression transiently at 26 hour post hatching. | Benjamini Hochberg corrected q-value < 0.01. | WBPaper00053388:dauer_regulated_Cluster3 | |
Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00065975:P-body_vs_WholeAnimal_depleted | |
Transcripts that showed significantly increased expression in wdr-5(ok1417);skn-1(lax188) comparing to in skn-1(lax188) at day 2 adult stage. | fold change > 2 | WBPaper00058711:wdr-5(ok1417)_upregulated | |
Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult. | The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak. | WBPaper00044736:oscillating_dev_expression | |
Transcripts that showed significantly increased expression in animals with germline-specific inx-14(RNAi) comparing to in aniamls fed with control vector, both exposed to PA14 infection. | DESeq2. Differentially-expressed genes (DEG) were identified based on two criteria: FDR (False discovery rateusing Benjamini-Hochberg adjusted p-values) < 0.01 and absolute value of log2(Fold Change) > 1. | WBPaper00066146:germline-inx-14(RNAi)_upregulated_PA14 | |
Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:daf-2(e1370)_upregulated |
13 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Strain: BC12765 | [toh-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGGTTATAAGCTCCGCCTATTG] 3' and primer B 5' [TTTTGTGGATGCTGAAATTAAAGT] 3'. | Expr6546 | ||
dpy-31 in this paper = toh-2 (WS145) | Expr3138 | A version of the pD31P3.4G construct devoid of NLS (pD31P3.4G-N) confirmed this expression pattern. In transgenic animals carrying pD31P3.4G-N, GFP was detected in most hypodermal cells, except in the seam cells of larval stages. Expression of DPY-31 is particularly pronounced at all life stages in the amphid socket cells at the anterior end of the animal and in the rectal epithelial cells at the posterior end. In L4 and adults, DPY-31 expression was also seen in the vulval epithelial cells. Fluorescence was also observed in some head neurons, although the identity of such neurons has not been determined. Transgenic worms carrying pD31P3.4G express GFP in most hypodermal nuclei throughout the life cycle. Expression was first detected in embryos at the twofold stage. The GFP signal was particularly intense in embryos and early larvae. | ||
Picture: N.A. | Expr8930 | Expressed in all intestinal cells(weak), major hypodermis, vulva epithelium, rectal epithelium, AMsh, IL/OLso and excretory duct cell. | ||
Expr1032725 | Tiling arrays expression graphs | |||
Curated by authors based on online in-situ hybridization database (Y. Kohara, personal communication; http://nematode.lab.nig.ac.jp). | Expr4074 | Expressed in embryo/intestine. | ||
Expr10273 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
Expr2011072 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Original chronogram file: chronogram.1829.xml | [R151.5:gfp] transcriptional fusion. | Chronogram789 | ||
Expr1155621 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
Expr10272 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
Expr2029309 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Expr1010535 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
Original chronogram file: chronogram.70.xml | [R151.5:gfp] transcriptional fusion. | Chronogram1787 |
12 GO Annotation
Annotation Extension | Qualifier |
---|---|
enables | |
enables | |
enables | |
enables | |
enables | |
located_in | |
located_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
enables |
12 Ontology Annotations
Annotation Extension | Qualifier |
---|---|
enables | |
enables | |
enables | |
enables | |
enables | |
located_in | |
located_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
enables |
1 Upstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrIII_7201772..7202205 | 434 | III: 7201772-7202205 | Caenorhabditis elegans |