WormMine: Gene WBGene00006775

• WormBase Gene ID: WBGene00006775
• Gene Name: unc-39
• Sequence Name: F56A12.1
• Brief Description: unc-39 encodes a homeodomain transcription factor that belongs to the Six4/5 family of homeodomain proteins that includes human Six5; UNC-39 is required for axonal pathfinding in anterior-derived neurons and for specification of most mesodermal cell types and may regulate a developmental decision between migration and differentiation; UNC-39 is expressed in the embryo in anterior neurons, posteriorly derived mesoderm (somatic gonad, M mesoblast, and possibly the coelomocytes and muIntR), the CAN neurons, and body wall muscle.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in several processes, including egg-laying behavior; generation of neurons; and regulation of locomotion. Located in nucleus. Expressed in several structures, including AIA; IL2 neuron; RID; coelomocyte; and neuroblasts. Used to study branchiootorenal syndrome and myotonic dystrophy type 1. Human ortholog(s) of this gene implicated in branchiootorenal syndrome 2. Is an ortholog of human SIX4 (SIX homeobox 4) and SIX5 (SIX homeobox 5).
• Biotype: SO:0001217
• Genetic Position: V :6.28117 ±0.001023
• Length (nt): 2808

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006775

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F56A12.1.1	F56A12.1.1	1405	V: 14373074-14375881

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F56A12.1	F56A12.1	1008	V: 14373389-14373691

10 RNAi Result

• WBRNAi00061182
• WBRNAi00089718
• WBRNAi00048581
• WBRNAi00114716
• WBRNAi00015762
• WBRNAi00032912
• WBRNAi00101784
• WBRNAi00089999
• WBRNAi00090158
• WBRNAi00090317

43 Allele

• gk963271
• gk962657
• gk963706
• gk962658
• gk963301
• gk964458
• gk964459
• gk963796
• WBVar02062271
• e257
• WBVar00015935
• ok2137
• hp701
• WBVar00015940
• WBVar00015945
• gk829728
• gk642933
• gk538307
• gk473270
• gk559353
• gk414306
• gk552324
• gk631854
• WBVar01871810
• gk603123
• WBVar01871811
• gk937574
• WBVar01871812
• WBVar01871813
• WBVar01871809

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006775
• Start: 14373074
• End: 14375881
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_14375882..14375995
• Length (nt): 114
• Chromosome Location: V: 14375882-14375995
• Organism: Caenorhabditis elegans

159 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in his-3(RNAi) comparing to in vector control animals.	The limma package47 was used for differential expression. Genes with a Benjamini-Hochberg adjusted P-value <0.05 and an absolute log fold change of 2 were considered differentially expressed.	WBPaper00053402:his-3(RNAi)_upregulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly increased expression in wdr-5(ok1417);skn-1(lax188) comparing to in skn-1(lax188) at day 2 adult stage.	fold change > 2	WBPaper00058711:wdr-5(ok1417)_upregulated
	Transcripts that showed significantly decreased expression in 10-days post L4 adult hermaphrodite npr-8(ok1439) animals grown at 20C, comparing to in N2 animals.	CuffDiff, fold change > 2.	WBPaper00065096:npr-8(ok1439)_downregulated_Day10_20C
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in spt-16(RNAi) comparing to in vector control worm at L4 larva stage.	DESeq 2, fold change > 4, adjusted p-value < 0.05.	WBPaper00055013:spt-16(RNAi)_upregulated
	Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector.	p-value <= 0.05	WBPaper00066902:cat-1(RNAi)_regulated
	Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector.	DESeq2. FDR < 0.05.	WBPaper00060459:bcat-1(RNAi)_downregulated
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated

12 Expression Patterns

• Primary Identifier: Expr6209
• Remark: Strain: BC12918
• Reporter Gene: [ceh-35::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACACAGCTGCCAATAACACATACT] 3' and primer B 5' [CGGATGGTCTGTGATGAAATAA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons

• Primary Identifier: Expr13662
• Pattern: unc-39 reporters were expressed by muscles and multiple neurons during embryonic development and into the adulthood. Notably, robust expression of unc-39 reporters was observed in the embryonic RID precursor, embryonic RID, and newly hatched L1 larvae. Post-embryonically, unc-39 expression was selectively decreased in some neurons, including RID.

• Primary Identifier: Expr7585
• Remark: Clone: pUL#JRH8H6
• Pattern: Early and comma stage embryos show expression in several cells at the very anterior. From late embryo to adult, expression is seen in two pairs of nerves in the head with process linking them and then to the tip of the head.

• Primary Identifier: Expr15439

• Primary Identifier: Expr15642

• Primary Identifier: Expr2036007
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1032847
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr3094
• Pattern: At approximately 240 min post-fertilization, UNC-39::GFP appeared in more posteriorly located nuclei in addition to the anterior nuclei. Posterior nuclei expressing unc-39::gfp included Z1 and Z4, the M cell, and the embryonic coelomocytes. Occasionally expressed in additional posteriorly located cells. Expression in M and the coelomocytes was transient and no longer observed by 600 min post-fertilization, whereas Z1 and Z4 expression persisted into the L1 larval stage. Expression of the full-length unc-39::gfp transgene was dynamic throughout development. UNC-39::GFP was first seen at approximately 100 min post-fertilization when gastrulation and embryonic transcription begin. UNC-39::GFP accumulated in the nuclei of 12 to 16 blast cells in the anterior of the embryo. As embryogenesis proceeded, expression was observed in increasing numbers of anterior nuclei which were most likely the descendants of the earlier-expressing cells, as UNC-39::GFP-expressing pairs of cells in the process of cell division were observed. Expression in anterior nuclei continued until about 450 min post-fertilization (2-fold stage), at which time expression became restricted to less than 10 cells and persisted into adulthood. The locations and morphologies of some of these cells indicated that they were anterior neuroblasts derived from the AB lineage. In addition to expression in the anteriorly generated mesodermal Z1, Z4, M, and coelomocytes, the unc-39 promoter was active in all of the body wall muscle cells of late embryos and L1 larvae. Thus, unc-39::gfp transgenes were expressed very early in embryogenesis in anterior cells that generate neuronal and mesodermal tissues, and later in body wall muscle cells. The 4-kb unc-39 promoter driving the expression of gfp alone showed a similar general pattern. However, expression of this construct persisted in a greater number of anterior cells into larval and adult stages. These cells had axon and dendrite morphologies characteristic of amphid sensory neurons. Furthermore, the CAN neuron clearly showed unc-39 promoter expression.

• Primary Identifier: Expr1152365
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1028212
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2017871
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1494
• Remark: Original chronogram file: chronogram.369.xml
• Reporter Gene: [F56A12.1:gfp] transcriptional fusion.

23 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006775
• Start: 14373074
• End: 14375881
• Strand: 1

23 Ontology Annotations

1 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes regulated by unc-39(hp701). Authors compared genes enriched in FACS sorted GFP+ cells (RID, ALA, AIY, CAN and a sheath cell) vs. whole animal in WT hpIs202[Pceh-10GFP] (WT enriched sets), and genes enriched in FACS sorted GFP+ cells (ALA, AIY, CAN and a sheath cell) vs. whole animal in unc-39(hp701) hpIs202[Pceh-10GFP] (unc-39 enriched sets) at L2 larva stage. This set of genes are WT enriched but not unc-39 enriched, suggesting they are enriched in RID neurons.	DESeq	WBPaper00050496:unc-39(hp701)_regulated

1 Sequence

• Length: 2808

1 Sequence Ontology Term

• Name: gene

13 Strains

• WBStrain00027367
• WBStrain00030565
• WBStrain00033528
• WBStrain00036815
• WBStrain00036766
• WBStrain00036790
• WBStrain00052173
• WBStrain00055142
• WBStrain00055005
• WBStrain00055028
• WBStrain00006218
• WBStrain00005888
• WBStrain00004136

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_14369877..14373073
• Length (nt): 3197
• Chromosome Location: V: 14369877-14373073
• Organism: Caenorhabditis elegans