WormMine: Gene WBGene00006810

• WormBase Gene ID: WBGene00006810
• Gene Name: unc-78
• Sequence Name: C04F6.4
• Brief Description: unc-78 encodes a WD40 repeat-containing protein homologous to actin-interacting protein (AIP1) that regulates the ordered assembly of actin and cofilin in myofibrils; homozygous unc-78 mutant animals are viable but exhibit disorganization of actin filaments in the body wall muscle; unc-78 and aipl-1 have redundant and overlapping functions in organized assembly of actin filaments in embryonic muscle and that unc-78 and aipl-1 double mutant is embryonic lethal; both isoforms preferentially cooperate with UNC-60B, a muscle-specific ADF/cofilin for actin filament disassembly in embryonic muscle; UNC-78 is expressed in embryonic pharynx and body wall muscles; in adults it is expressed in spermatheca, the myoepithelial sheath, the uterus, adult vulva; UNC-78 isoform majorly functions in post-embryonic muscle most likely due to its expression in larval and adult muscles and that AIPL-1 can compensate for the function of UNC-78 in the body wall muscle.
• Organism: Caenorhabditis elegans
• Automated Description: Enables actin filament binding activity. Involved in several processes, including myofibril assembly; regulation of actin polymerization or depolymerization; and regulation of locomotion. Located in myofibril and sarcoplasm. Expressed in body wall musculature; pharynx; spermatheca; uterus; and vulva. Is an ortholog of human WDR1 (WD repeat domain 1).
• Biotype: SO:0001217
• Genetic Position: X :-10.3431 ±0.00338
• Length (nt): 2942

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006810

Genomics

2 Transcripts

Class	WormMine ID	Sequence Name	Length (nt)	Chromosome Location
MRNA	Transcript:C04F6.4a.1	C04F6.4a.1	1982	X: 3408674-3411615
NcPrimaryTranscript	Transcript:C04F6.4b	C04F6.4b	1884	X: 3408819-3411614

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C04F6.4a	C04F6.4a	1836	X: 3408819-3408925

20 RNAi Result

• WBRNAi00108011
• WBRNAi00089751
• WBRNAi00039653
• WBRNAi00008336
• WBRNAi00065620
• WBRNAi00024465
• WBRNAi00086429
• WBRNAi00028455
• WBRNAi00060100
• WBRNAi00060101
• WBRNAi00086427
• WBRNAi00060098
• WBRNAi00060099
• WBRNAi00089976
• WBRNAi00090135
• WBRNAi00090294
• WBRNAi00090381
• WBRNAi00090428
• WBRNAi00090475
• WBRNAi00090522

45 Allele

• gk963725
• gk964260
• gk963797
• gk963798
• gk963370
• st43
• su135
• su152
• su187
• gk963371
• gk950943
• e1221
• e1217
• h3861
• gk27
• gk275785
• gk275784
• gk275783
• gk519160
• gk275782
• gk275781
• gk895734
• gk931210
• gk802424
• WBVar01468268
• gk810472
• gk391252
• gk723909
• gk760861
• gk673093

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006810
• Start: 3408674
• End: 3411615
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_3408604..3408673
• Length (nt): 70
• Chromosome Location: X: 3408604-3408673
• Organism: Caenorhabditis elegans

138 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals.	Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed.	WBPaper00062193:skn-1(RNAi)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in pgl-1(ct131) animals (isolated from SS0002[pgl-1(ct131)him-3(e1147)], comparing to in control animals SS1174, at 1-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_pgl-1(ct131)_vs_control_day1-adult
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L1-larva_expressed
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes

11 Expression Patterns

• Primary Identifier: Expr4294
• Remark: No GO_term assigned.
• Pattern: Expression of GFP-UNC-78 was detected in the pharynx, body wall muscle, spermatheca, and vulva.
• Subcellular Localization: The GFP-UNC-78 fusion protein localized in a striated pattern in live animals.

• Primary Identifier: Expr5149
• Remark: Strain: BC11696
• Reporter Gene: [unc-78::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAAAGTTGATCACCGATTGAAGC] 3' and primer B 5' [TCCGAGATTCTGCAAAAATTG] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; Larval Expression: pharynx; anal depressor muscle; body wall muscle

• Primary Identifier: Expr2688
• Remark: Staining of unc-78 null mutants with anti-UNC-78 antibody did not yield these patterns, indicating that striated staining is specific for reactivity with UNC-78.
• Pattern: Immunolocalization of UNC-78 revealed that UNC-78 is expressed in a tissue-specific manner. In embryos, faint staining of UNC-78 was first detected in a subset of cells at the 1.5-fold stage (~350 minutes after the first cell division). In the later embryonic stages, UNC-78 was expressed in the body wall muscle and also more strongly in the pharynx. In adults, UNC-78 was expressed in the body wall muscle, pharynx and spermatheca.
• Subcellular Localization: In 1.5-fold embryos: The UNC-78-positive regions were adjacent to the nascent myofibrils in body wall muscle where the muscle-specific myosin heavy chain myoA was localized, suggesting that UNC-78 is localized in the diffuse cytoplasm of the body wall muscle cells. In later embryos, in the pharynx and spermatheca, subcellular localization of UNC-78 was not clear owing to poor penetration of the antibody into these tissues. In the body wall muscle, UNC-78 was localized in a striated pattern that was co-localized with actin but not with the myosin heavy chain myoA. However, since the striation of UNC-78 was not as sharp as that of actin, it was difficult to determine precise location of UNC-78 within the thin filaments.

• Primary Identifier: Expr11521
• Remark: Temporal description
• Pattern: unc-78 is expressed in the pharynx and the body wall muscle from embryos to adults and the spermatheca, the myoepithelial sheath, the uterus, and the vulva only in adults. In the body wall muscle, expression of UNC-78 was first detected at the 1.5-fold stage, but its level was very low. Expression patterns of aipl-1 and unc-78 overlap in the body wall muscle and the spermatheca.

• Primary Identifier: Expr2036043
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1032876
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1020277
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram992
• Remark: Original chronogram file: chronogram.2046.xml
• Reporter Gene: [C04F6.4:gfp] transcriptional fusion.

• Primary Identifier: Expr1143746
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2017907
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr3580
• Subcellular Localization: Diffuse in nerve cords.

22 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006810
• Start: 3408674
• End: 3411615
• Strand: -1

22 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2942

1 Sequence Ontology Term

• Name: gene

6 Strains

• WBStrain00026896
• WBStrain00033511
• WBStrain00035493
• WBStrain00001852
• WBStrain00006316
• WBStrain00004274

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_3411616..3411984
• Length (nt): 369
• Chromosome Location: X: 3411616-3411984
• Organism: Caenorhabditis elegans