WormMine: Gene WBGene00007013

• WormBase Gene ID: WBGene00007013
• Gene Name: mdt-8
• Sequence Name: Y62F5A.1
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable RNA polymerase II cis-regulatory region sequence-specific DNA binding activity and transcription coregulator activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. Predicted to be part of core mediator complex and mediator complex. Is an ortholog of human MED8 (mediator complex subunit 8).
• Biotype: SO:0001217
• Genetic Position: II :3.62057 ±0.003541
• Length (nt): 6649

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00007013

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y62F5A.1a.1	Y62F5A.1a.1	1077	II: 11527168-11533816
Transcript:Y62F5A.1b.1	Y62F5A.1b.1	1079	II: 11527172-11533814

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y62F5A.1b	Y62F5A.1b	894	II: 11527357-11527370
CDS:Y62F5A.1a	Y62F5A.1a	978	II: 11527265-11527362

18 RNAi Result

• WBRNAi00075066
• WBRNAi00057857
• WBRNAi00112425
• WBRNAi00072772
• WBRNAi00087233
• WBRNAi00037679
• WBRNAi00075067
• WBRNAi00075068
• WBRNAi00075070
• WBRNAi00075063
• WBRNAi00075065
• WBRNAi00075064
• WBRNAi00075069
• WBRNAi00072773
• WBRNAi00026890
• WBRNAi00112416
• WBRNAi00085239
• WBRNAi00117663

77 Allele

• gk963801
• gk963053
• gk962684
• gk963539
• gk963482
• gk870820
• WBVar00229655
• WBVar01692051
• WBVar02067006
• WBVar01605098
• WBVar01605097
• WBVar01547106
• WBVar01784554
• gk155344
• gk155343
• gk155340
• gk155342
• gk155341
• WBVar00229653
• WBVar00229656
• WBVar01413957
• gk438415
• gk419726
• ttTi4702
• WBVar01666618
• WBVar01666620
• WBVar01440052
• WBVar01666619
• gk649619
• WBVar01792291

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00007013
• Start: 11527168
• End: 11533816
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_11527055..11527167
• Length (nt): 113
• Chromosome Location: II: 11527055-11527167
• Organism: Caenorhabditis elegans

120 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage.	DEseq2, fold change > 2	WBPaper00064505:tamoxifen_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated
	Transcripts that showed significantly depleted expression in sensory neuron (labeled by iaIs25[Pgcy-37::GFP + unc-119(+)]) comparing to in whole worm.	Fold change > 2, p-value < 0.05.	WBPaper00060661:sensory-neuron_depleted
	Transcripts that showed significantly decreased expression in pals-22(jy3) comparing to in N2 at L4 larva stage.	Differential expression analysis was performed in RStudio (v1.1.453) using R (v3.50) and Bioconductor (v3.7) packages. As outlined in the RNAseq123 vignette, data was imported, filtered and normalized using edgeR, and linear modeling and differential expression analysis was performed using limma. An FDR cutoff of <0.01 was used to define differentially expressed genes; no fold-change criteria was used.	WBPaper00056034:pals-22(jy3)_downregulated
	Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector.	Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples.	WBPaper00051039:germline_enriched
	Transcripts that showed significantly decreased expression in sek-1(km4) animals comparing to in N2 animals under both dietary (DR, OP50 OD = 0.1) and ad libtum (AL, OP50 OD = 3) conditions from 3-day post L4 till 6-day post L4 adult hermaphrodite stage.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:sek-1(km4)_downregulated
Bacteria infection: Xenorhabdus nematophila	Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila.	Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets.	WBPaper00041606:CE_X.nematophila_regulated
Bacteria diet: Lactobacillus rhamnosus CNCM I-3690	Differentially expressed genes between C.elegans fed with L.rhamnosus strain CNCM I-3690 and control strain E.coli OP50 after 3 days of feeding.	Differential expression was assayed via limma. Genes were considered differentially expressed when the multiple testing adjusted P-value < 0.01.	WBPaper00041906:I-3690_vs_OP50_3d
	Genes identified as down-regulated at a 5% false discovery rate through RNAseq experiments with three tatn-1(qd182) and three N2 RNA samples.	ANOVA with FDR <= 0.05.	WBPaper00044656:tatn-1(qd182)_downregulated
	Genes expressed in embryonic motor neurons (identified by unc-4::GFP expressing cells).	Genes called Present by MAS 5.0 in 2 out of 3 unc-4::GFP hybridizations.	WBPaper00025141:unc-4::GFP_Expressed_Genes
	Transcripts with significantly increased expression after treatment with 0.1mM paraquat vs. control	Comparisons of each genotype were compared to the wild-type using the Empirical Base (Wright & Simon) algorithm and fold changes were represented on a log2 scale. A threshold of p < 0.05 and a fold change of 1.3 (log2) was set to determine differentially expressed targets.	WBPaper00045263:0.1mM-paraquat_upregulated

7 Expression Patterns

• Primary Identifier: Expr7088
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11699
• Reporter Gene: [mdt-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTAAATTTATCTAAACATGCCGA] 3' and primer B 5' [TTGGATACTCGATCTGAACAAGG] 3'.
• Pattern: Adult Expression: pharynx; intestine; Larval Expression: pharynx; intestine

• Primary Identifier: Expr1033003
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram993
• Remark: Original chronogram file: chronogram.2047.xml
• Reporter Gene: [Y62F5A.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2013486
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1011508
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2031720
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1161291
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

10 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00007013
• Start: 11527168
• End: 11533816
• Strand: -1

10 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 6649

1 Sequence Ontology Term

• Name: gene

0 Strains

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_11533817..11533925
• Length (nt): 109
• Chromosome Location: II: 11533817-11533925
• Organism: Caenorhabditis elegans