WormMine: Gene WBGene00007139

• WormBase Gene ID: WBGene00007139
• Gene Name: mnp-1
• Sequence Name: B0285.7
• Brief Description: mnp-1 encodes a protein related to the M1 family of metalloproteinases, but whose sequence indicates that it is unlikely to be catalytically active (MNP-1 lacks three of the four essential zinc-binding amino acids); during embryonic development mnp-1 activity is required, likely cell autonomously, for migration of muscle cells from their lateral positions to their final positions close to the dorsal and ventral midlines and for proper body morphology; an MNP-1::GFP reporter fusion localizes to the plasma membrane and is expressed from the 400-cell stage of embryogenesis through the early first larval stage in body-wall muscle, the Z1 and Z4 somatic gonad precursors, and cells in the dorsal anterior region that are likely to be neuronal precursors.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to be located in cytoplasm; extracellular space; and membrane. Expressed in Z1; Z4; body wall musculature; neuroblasts; and neurons.
• Biotype: SO:0001217
• Genetic Position: III :-3.18292 ±0.000721
• Length (nt): 8386

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00007139

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:B0285.7.1	B0285.7.1	2822	III: 4356594-4364979

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:B0285.7	B0285.7	2346	III: 4356684-4357121

11 RNAi Result

• WBRNAi00038877
• WBRNAi00024375
• WBRNAi00027141
• WBRNAi00009670
• WBRNAi00005012
• WBRNAi00028062
• WBRNAi00072879
• WBRNAi00072878
• WBRNAi00072880
• WBRNAi00097957
• WBRNAi00103142

100 Allele

• gk521696
• gk709870
• gk362313
• gk172616
• gk172615
• WBVar02067491
• gk405962
• WBVar01262978
• WBVar01262979
• WBVar01262976
• WBVar01262977
• WBVar01262981
• WBVar01262980
• WBVar01541717
• h17588
• gk172618
• gk172617
• gk172612
• gk172611
• gk172614
• gk172613
• gk172624
• gk172623
• WBVar01709971
• gk172620
• gk172619
• gk172622
• gk172621
• gk671203
• gk683921

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00007139
• Start: 4356594
• End: 4364979
• Strand: 1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_4364980..4365273
• Length (nt): 294
• Chromosome Location: III: 4364980-4365273
• Organism: Caenorhabditis elegans

236 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Genes that showed increased expression in wdr-5(ok1417) comparing with in N2.	Statistical analysis for misexpression was performed using a moderated t test from the package limma. All genes with a false discovery rate (FDR) of <= 5% (p <= 0.05) were selected as differentially regulated.	WBPaper00045861:wdr-5(ok1417)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_18
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly decreased expression in lipl-4 overexpression transgenic lines comparing to wild type control animals.	DESeq2 fold change > 2, FDR < 0.05.	WBPaper00064156:lipl-4(overexpress)_downregulated
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
Bacteria diet: Lb.rhamnosus	Transcripts that showed significantly decreased expression in animals fed with heterofermentative LAB Lb. rhamnosus, comparing to animals fed with OP50 from day 1 to day 5 adult stage.	fold change > 2 and p value < 0.05 by Students t- test.	WBPaper00065392:Lb.rhamnosus_downregulated
Growth temperature	Transcripts that are significantly downregulated at 15C compared to both 25C and 20C, with no statistical difference between 25C and 20C, in worms feeding B. subtilis PY79.	DESeq2 and EdgeR, adjusted p-value < 0.05.	WBPaper00053814:15C_downregulated_PY79
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Transcripts that showed significantly increased expression in ubc-9(ne4833[ubc-9(G56R)] in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:ubc-9(ne4833)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult

9 Expression Patterns

• Primary Identifier: Expr5040
• Remark: Strain: BC12470
• Reporter Gene: [B0285.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTCAGGTGAATGTTGTTTCATGT] 3' and primer B 5' [GCGGAGTGATATGGGAAGTAAG] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Expr13910
• Pattern: In embryos with the Pmnp-1::mnp-1::gfp transgene, we first detected GFP at about 250 min after first cell division. Expression continued throughout the rest of embryonic and post embryonic development. By 350 min after first division GFP was detected in many cells whose positions suggested that they were muscle cell precursors. In 1.5-fold stage and older embryos, expression continued in putative muscle precursors. In addition, we detected GFP expression in cells whose positions were consistent with their being neuronal precursors. In young larvae through adult, Pmnp-1::mnp-1::gfp was expressed in body wall muscle cells and sometimes within neurons.

• Primary Identifier: Expr1033073
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr12667
• Pattern: To characterize the expression of mnp-1, reporter analysis was performed using an mnp-1p-GFP transgene containing 3 kb of upstream sequence driving a nuclear localized green fluorescent protein (GFP). At the comma stage (approximately 400 cells) and persistent through hatching, GFP expression was apparent in all of the body-wall muscle cells. At these embryonic stages, GFP expression is also seen in the migrating z1 and z4 gonadal precursor cells and a number of unidentified cells in the dorsal anterior region. These unidentified cells are likely neuronal precursors based on their position, although other cells types are not ruled out. After hatching, GFP expression fades quickly and is typically absent by mid to late L1 larval stage. To characterize the expression of mnp-1, reporter analysis was performed using an mnp-1p::GFP transgene containing 3 kb of upstream sequence driving a nuclear localized green fluorescent protein (GFP). At the comma stage (approximately 400 cells) and persistent through hatching, GFP expression was apparent in all of the body-wall muscle cells. At these embryonic stages, GFP expression is also seen in the migrating z1 and z4 gonadal precursor cells and a number of unidentified cells in the dorsal anterior region. These unidentified cells are likely neuronal precursors based on their position, although other cells types are not ruled out. After hatching, GFP expression fades quickly and is typically absent by mid to late L1 larval stage.
• Subcellular Localization: Expression clearly localized GFP proximal to the plasma membrane of embryonic muscle cells, suggesting that the portion of MNP-1 containing the predicted transmembrane domain is sufficient to direct localization to the plasma membrane.

• Primary Identifier: Expr2013632
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1143065
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1013645
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2031866
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1270
• Remark: Original chronogram file: chronogram.2392.xml
• Reporter Gene: [B0285.7:gfp] transcriptional fusion.

8 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00007139
• Start: 4356594
• End: 4364979
• Strand: 1

8 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 8386

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00032571
• WBStrain00055655
• WBStrain00002163

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_4355980..4356593
• Length (nt): 614
• Chromosome Location: III: 4355980-4356593
• Organism: Caenorhabditis elegans