WormMine: Gene WBGene00007200

• WormBase Gene ID: WBGene00007200
• Gene Name: vamp-8
• Sequence Name: B0513.9
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable SNAP receptor activity and SNARE binding activity. Predicted to be involved in exocytosis and vesicle fusion. Predicted to be located in membrane. Predicted to be part of SNARE complex. Is an ortholog of human VAMP8 (vesicle associated membrane protein 8).
• Biotype: SO:0001217
• Genetic Position: IV :10.8857±
• Length (nt): 4830

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00007200

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:B0513.9a.1	B0513.9a.1	433	IV: 13860367-13865196
Transcript:B0513.9b.1	B0513.9b.1	416	IV: 13860375-13861384

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:B0513.9a	B0513.9a	351	IV: 13860449-13860613
CDS:B0513.9b	B0513.9b	342	IV: 13860449-13860613

1 RNAi Result

• WBRNAi00039163

82 Allele

• otn10081
• gk964078
• gk963546
• gk963547
• gk964500
• gk962765
• gk964111
• gk964110
• WBVar01860034
• gk963691
• gk432427
• gk419808
• gk312195
• gk631786
• gk618504
• gk440126
• gk716988
• gk343080
• gk551152
• gk921762
• gk343079
• gk539596
• gk428584
• gk618505
• gk804776
• gk847244
• gk872588
• gk636313
• gk452298
• gk963692

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00007200
• Start: 13860367
• End: 13865196
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

160 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in nhr-114(gk849) comparing to wild type animals at L4 larva.	DESeq2 1.26.0, fold change > 2, FDR < 0.05.	WBPaper00064539:nhr-114(gk849)_upregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Transcripts that showed significantly increased expression in adr-1(tm668) and adr-1(gv6) comparing to in N2 at embryo stage.	DESeq FDR <= 0.05	WBPaper00056617:adr-1_upregulated_embryo_transcript
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage.	DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed.	WBPaper00048971:daf-16(mgDf50)_downregulated_L1
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly increased expression in animal with pgph-2 overepxreesion [pgph-2p-pgph-2; myo-2p-mcherry] in glucose excess condition.	Genes with anadjusted P-value <= 0.05 found by DESeq2 were assigned as differentially expressed.	WBPaper00065926:pgph-2(overepxreesion)_upregulated_glucose
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in cco-1(RNAi) comparing to in vector control animals.	The limma package47 was used for differential expression. Genes with a Benjamini-Hochberg adjusted P-value <0.05 and an absolute log fold change of 2 were considered differentially expressed.	WBPaper00053402:cco-1(RNAi)_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly decreased expression among worms with highly oxidized glutathione, comparing to worms with below average oxidized glutathion.	FDR <= 0.05, fold change >= 1.5.	WBPaper00058927:high-redox-state_downregulated
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated

5 Expression Patterns

• Primary Identifier: Expr5082
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10446
• Reporter Gene: [B0513.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTGCATCTCGAGTACAGAAAA] 3' and primer B 5' [CCATGATTCTTTACCAGTGGTGT] 3'.
• Pattern: Adult Expression: pharynx; Nervous System; tail neurons; Larval Expression: pharynx; Nervous System; tail neurons

• Primary Identifier: Expr2036094
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1012721
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1143314
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2017958
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

8 GO Annotation

3 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00007200
• Start: 13860367
• End: 13865196
• Strand: -1

8 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4830

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00037837
• WBStrain00001352

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_13865197..13865590
• Length (nt): 394
• Chromosome Location: IV: 13865197-13865590
• Organism: Caenorhabditis elegans