WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00007554 Gene Name  pptr-2
Sequence Name  ? C13G3.3 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable protein phosphatase activator activity. Involved in P granule assembly. Predicted to be located in cytosol and nucleus. Predicted to be part of protein phosphatase type 2A complex. Expressed in head and tail. Human ortholog(s) of this gene implicated in autosomal dominant intellectual developmental disorder 35. Is an ortholog of human PPP2R5D (protein phosphatase 2 regulatory subunit B'delta). Biotype  SO:0001217
Genetic Position  V :2.89875 ±0.004967 Length (nt)  ? 7901
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00007554

Genomics

9 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C13G3.3b.2 C13G3.3b.2 2340   V: 11027031-11030846
Transcript:C13G3.3a.1 C13G3.3a.1 2039   V: 11027153-11029387
Transcript:C13G3.3b.1 C13G3.3b.1 2051   V: 11027153-11029387
Transcript:C13G3.3b.3 C13G3.3b.3 2135   V: 11027153-11030546
Transcript:C13G3.3a.4 C13G3.3a.4 2109   V: 11027167-11030546
Transcript:C13G3.3a.3 C13G3.3a.3 2376   V: 11027167-11034931
Transcript:C13G3.3a.2 C13G3.3a.2 2179   V: 11027179-11030845
Transcript:C13G3.3d.1 C13G3.3d.1 1725   V: 11027513-11030508
Transcript:C13G3.3c.1 C13G3.3c.1 1824   V: 11027513-11030824
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C13G3.3c C13G3.3c 1824   V: 11027513-11027656
CDS:C13G3.3a C13G3.3a 1674   V: 11027513-11027656
CDS:C13G3.3b C13G3.3b 1686   V: 11027513-11027656
CDS:C13G3.3d C13G3.3d 1725   V: 11027513-11027656

11 RNAi Result

WormBase ID
WBRNAi00040455
WBRNAi00010699
WBRNAi00086450
WBRNAi00086451
WBRNAi00033277
WBRNAi00085912
WBRNAi00064518
WBRNAi00085913
WBRNAi00086448
WBRNAi00062121
WBRNAi00079107

105 Allele

Public Name
gk963301
gk964451
gk964452
gk936359
gk331424
gk806673
gk764138
gk558425
gk933937
gk857133
gk793583
gk673034
gk835180
gk311750
gk406966
gk798197
gk642349
gk712415
gk901331
gk515602
gk675961
gk846791
gk358778
gk936358
gk521910
gk696415
gk479586
gk548729
gk729126
gk680022

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00007554 11027031 11034931 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_11022938..11027030   4093 V: 11022938-11027030 Caenorhabditis elegans

128 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage. DEseq2, fold change > 2 WBPaper00064505:tamoxifen_upregulated
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:Day10_vs_Day1_upregulated
  Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage. DESeq2, fold change > 2 WBPaper00058725:sftb-1(cer6)_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:Cisplatin_downregulated_WT
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
Fungi infection: Haptoglossa zoospora. Transcripts that showed significantly altered expression after L4 N2 animals were exposed to omycete Haptoglossa zoospora for 6 hours. Kalisto abundance files were converted and analysed using Sleuth in a R pipeline. Standard Sleuth protocols were used to calculate differential expression. P value < 0.01 and FDR < 0.01. WBPaper00062354:H.zoospora_6h_regulated
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
  Proteins identified in extracellular vesicle. N.A. WBPaper00062669:extracellular-vesicle_protein
  Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C. EdgeR, FDR < 0.05, fold change < 0.5. WBPaper00055971:nhl-2(ok818)_25C_upregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts of coding genes that showed significantly increased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_enriched_coding-RNA

12 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC13890 [C13G3.3a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACAATACCCTAAAAATCCCAACA] 3' and primer B 5' [GAAATGATAAATATGAGGGCCG] 3'. Expr5260 Adult Expression: anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ;  
Strain: BC14496 [C13G3.3b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGTTCCGCAGACGC] 3' and primer B 5' [TGCAGGAATGATATCTCCTAGAAA] 3'. Expr5261 Adult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;  
    Expr1033250 Tiling arrays expression graphs  
Original chronogram file: chronogram.2024.xml [C13G3.3:gfp] transcriptional fusion. Chronogram970    
    Expr1144521 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2015024 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr15729   anti-PPTR-1 localizes to I-bands, and anti-PPTR-2 localizes to M-lines and dense bodies.
Original chronogram file: chronogram.481.xml [C13G3.3:gfp] transcriptional fusion. Chronogram1600    
    Expr1016053 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2033259 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.694.xml [C13G3.3:gfp] transcriptional fusion. Chronogram1780    
Original chronogram file: chronogram.743.xml [C13G3.3:gfp] transcriptional fusion. Chronogram1833    

13 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  part_of
  part_of
  part_of
  located_in
  located_in
occurs_in(WBbt:0004422),happens_during(GO:0030010) involved_in
  involved_in
  enables

11 Homologues

Type
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00007554 11027031 11034931 -1

13 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  part_of
  part_of
  part_of
  located_in
  located_in
occurs_in(WBbt:0004422),happens_during(GO:0030010) involved_in
  involved_in
  enables

0 Regulates Expr Cluster

1 Sequence

Length
7901

1 Sequence Ontology Term

Identifier Name Description
gene  

4 Strains

WormBase ID
WBStrain00032037
WBStrain00002773
WBStrain00003064
WBStrain00002834

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_11034932..11036176   1245 V: 11034932-11036176 Caenorhabditis elegans