WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00006985 Gene Name  zig-8
Sequence Name  ? Y39E4B.8 Brief Description  zig-8 encodes a predicted secreted protein that is a member of the immunoglobulin superfamily of proteins; a zig-8::gfp reporter fusion is expressed in the PVT neuron and in pharyngeal muscle.
Organism  Caenorhabditis elegans Automated Description  Predicted to be involved in synapse organization. Predicted to be located in neuron projection membrane. Expressed in PVT; head; and pharyngeal muscle cell.
Biotype  SO:0001217 Genetic Position  III :20.7774 ±0.014666
Length (nt)  ? 14119
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00006985

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:Y39E4B.8.1 Y39E4B.8.1 973   III: 13119820-13133938
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:Y39E4B.8 Y39E4B.8 807   III: 13119859-13119913

3 RNAi Result

WormBase ID
WBRNAi00056250
WBRNAi00020406
WBRNAi00036950

216 Allele

Public Name
gk963887
gk963904
gk963552
gk189858
gk189857
gk189860
gk189859
gk189862
gk189861
gk189886
gk189885
gk189887
gk189864
gk189863
gk189866
gk189865
gk189867
gk189869
gk189868
gk189871
gk189870
gk189873
gk189872
gk189875
gk189874
gk189876
gk189878
gk189877
gk189880
gk189879

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00006985 13119820 13133938 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

167 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_larva_enriched
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
  Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage. DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed signifcantly increased expression in pabp-2(RNAi) animals comparing to in N2 animals injected with empty vector at L1 larva stage and collected at L4 larva stage. FDR < 0.05, fold change > 2 WBPaper00067368:pabp-2(RNAi)_upregulated_N2
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva. Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage. DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3. WBPaper00058958:100mGy-irradiation-72h_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2. DESeq 2, fold change > 2, FDR < 0.05. WBPaper00065581:hpk-1(pk1393)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain. RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis. WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. DESeq2, FDR <0.05, fold change > 2. WBPaper00059664:srbc-48(ac23)_upregulated
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals. DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction. WBPaper00060014:set-2(tm1630)_downregulated
Starvation Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl) DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:starvation_regulated_LowSalt

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1019627 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Strain: BC11425 [zig-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTATGAAAAACCACCACACTCTG] 3' and primer B 5' [TTCGAAAACCTTCGGATTTTTA] 3'. Expr6957 Adult Expression: Nervous System; head neurons; tail neurons; unidentified cells in head; Larval Expression: Nervous System; head neurons; tail neurons; unidentified cells in head;  
    Expr2036284 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1032986 Tiling arrays expression graphs  
    Expr1754 Expression is activated postembryonically in the first larval (L1) stage. Neuronal expression in: PVT Non-neuronal expression in: pharyngeal muscle  
Original chronogram file: chronogram.1311.xml [Y39E4B.8:gfp] transcriptional fusion. Chronogram289    
    Expr2018147 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1159734 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

4 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in

21 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
orthologue
orthologue
orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00006985 13119820 13133938 1

4 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
14119

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00031492
WBStrain00001759

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_13118815..13119819   1005 III: 13118815-13119819 Caenorhabditis elegans