Genomics
2 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:C08B11.3b.1 | C08B11.3b.1 |
4268
![]() |
II: 8022632-8027763 |
Transcript:C08B11.3a.1 | C08B11.3a.1 |
4384
![]() |
II: 8022645-8027763 |
Other
2 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:C08B11.3a | C08B11.3a |
3735
![]() |
II: 8023273-8023401 |
CDS:C08B11.3b | C08B11.3b |
3606
![]() |
II: 8023273-8023401 |
63 Allele
Public Name |
---|
gk963801 |
gk963053 |
gk962682 |
WBVar01695696 |
WBVar01695695 |
WBVar01376122 |
gk313194 |
gk690795 |
gk654214 |
gk360943 |
gk795258 |
gk394607 |
gk341482 |
gk733569 |
gk683853 |
gk690794 |
gk774467 |
gk339210 |
gk722072 |
gk620053 |
gk486979 |
gk692884 |
gk907856 |
gk364760 |
gk333186 |
gk722071 |
gk907011 |
gk629544 |
gk382554 |
gk572621 |
1 Chromosome Location
Feature . Primary Identifier |
Start | End | Strand |
---|---|---|---|
WBGene00007433 | 8022632 | 8027763 | -1 |
4 Data Sets
Name | URL |
---|---|
WormBaseAcedbConverter | |
GO Annotation data set | |
C. elegans genomic annotations (GFF3 Gene) | |
Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrII_8022562..8022631 | 70 | II: 8022562-8022631 | Caenorhabditis elegans |
175 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Genes with expression altered >= 3-fold in dpy-10(e128) mutants. | Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). | WBPaper00035873:dpy-10_regulated | |
Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. | Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. | DESeq2 fold change > 2, p-value < 0.01. | WBPaper00061007:S.aquatilis_downregulated |
Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
starvation 12 hours | Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals. | EdgeR, FDR < 0.05, fold change >= 2. | WBPaper00067259:starvation_upregulated_intestine |
Transgeneration hypoxia treatment. | Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage. | For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR. | WBPaper00064871:hypoxia_upregulated_F1 |
Heat Shock: 35C 4 hours at L4 larva stage. | Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours | DESeq2 | WBPaper00057154:HeatShock_downregulated_mRNA |
Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. | DESeq | WBPaper00053302:stavudine_24h_regulated | |
25C vs. 20C | Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C. | CuffDiff, fold change > 2. | WBPaper00065096:25C_vs_20C_upregulated |
Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. | CuffDiff, fold change > 2. | WBPaper00065096:Day10_vs_Day1_upregulated | |
Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. | The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. | WBPaper00065373:Cisplatin_downregulated_WT | |
Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage. | DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. | WBPaper00066110:tetraploid_vs_diploid_downregulated | |
Transcripts that showed significantly increased expression in pry-1(mu38) animals comparing to in N2 at L1 larva stage. | DESeq, FDR < 0.05 | WBPaper00055626:pry-1(mu38)_upregulated | |
Bacteria: B.thuringiensis | Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point on the non pathogenic strain Bt407 compared to E. coli OP50. | Cuffdiff | WBPaper00060358:B.thuringiensis_non-pathogen_regulated_elt-2(RNAi) |
Bacteria: B.thuringiensis | Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. | Cuffdiff | WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi) |
Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector. | DESeq2. FDR < 0.05. | WBPaper00060459:bcat-1(RNAi)_downregulated | |
Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C. | EdgeR, FDR < 0.05, fold change < 0.5. | WBPaper00055971:nhl-2(ok818)_25C_upregulated | |
Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background. | DESeq2, FDR < 0.05 | WBPaper00060683:hlh-11(ko1)_downregulated |
10 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Also expressed in (comments from author) : Mosaic population. Strain: BC13898 | [C08B11.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCAAGCATGCTCCATTG] 3' and primer B 5' [TTTCCGACTCTCGATTTTCAA] 3'. | Expr5205 | Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |
Expr2035297 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Expr1033201 | Tiling arrays expression graphs | |||
Original chronogram file: chronogram.1014.xml | [C08B11.3:gfp] transcriptional fusion. | Chronogram19 | ||
Expr10221 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
Expr10220 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
Expr1144126 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
Expr1028527 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
Expr2017161 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Expr11490 | SWSN-7::GFP was expressed ubiquitously and localized to nuclei throughout development. |
9 GO Annotation
Annotation Extension | Qualifier |
---|---|
involved_in | |
involved_in | |
involved_in | |
enables | |
enables | |
part_of | |
involved_in | |
involved_in | |
involved_in |
4 Homologues
Type |
---|
least diverged orthologue |
least diverged orthologue |
least diverged orthologue |
least diverged orthologue |
9 Ontology Annotations
Annotation Extension | Qualifier |
---|---|
involved_in | |
involved_in | |
involved_in | |
enables | |
enables | |
part_of | |
involved_in | |
involved_in | |
involved_in |
1 Upstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrII_8027764..8028059 | 296 | II: 8027764-8028059 | Caenorhabditis elegans |