WormMine: Gene WBGene00008877

• WormBase Gene ID: WBGene00008877
• Gene Name: rtcb-1
• Sequence Name: F16A11.2
• Brief Description: rtcb-1 encodes the C. elegans ortholog of the mammalian tRNA splicing ligase RTCB; in C. elegans RTCB-1 is required for the ligation of tRNA halves during pre-tRNA processing, and for ligation of mRNAs, including the xbp-1 mRNA that is critical for proper execution of the endoplasmic reticulum unfolded protein response; when expressed in intestinal cells, an RTCB-1 reporter localizes to both the nucleus and the cytoplasm.
• Organism: Caenorhabditis elegans
• Automated Description: Enables RNA ligase (ATP) activity and RNA ligase (GTP) activity. Involved in IRE1-mediated unfolded protein response. Acts upstream of or within with a positive effect on germ cell development and vulval development. Located in cytoplasm and nucleus. Used to study Parkinson's disease. Is an ortholog of human RTCB (RNA 2',3'-cyclic phosphate and 5'-OH ligase).
• Biotype: SO:0001217
• Genetic Position: I :3.75935±
• Length (nt): 2263

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00008877

Genomics

2 Transcripts

Class	WormMine ID	Sequence Name	Length (nt)	Chromosome Location
MRNA	Transcript:F16A11.2a.1	F16A11.2a.1	1640	I: 9390833-9393095
NcPrimaryTranscript	Transcript:F16A11.2b	F16A11.2b	1586	I: 9390834-9393094

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F16A11.2a	F16A11.2a	1518	I: 9390954-9391181

8 RNAi Result

• WBRNAi00044772
• WBRNAi00003394
• WBRNAi00076309
• WBRNAi00008148
• WBRNAi00025117
• WBRNAi00025118
• WBRNAi00065397
• WBRNAi00116595

31 Allele

• gk962858
• gk962706
• gk963902
• gk963849
• gk964316
• WBVar01694844
• gk451
• WBVar01342356
• gk118673
• gk118674
• WBVar01910068
• WBVar01910069
• WBVar01910070
• gk346885
• gk883645
• WBVar01910067
• gk587229
• gk118675
• gk757344
• gk118676
• gk900975
• gk736364
• gk385329
• gk738887
• gk315386
• gk749374
• gk590326
• gk781607
• gk694551
• gk345999

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00008877
• Start: 9390833
• End: 9393095
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_9389983..9390832
• Length (nt): 850
• Chromosome Location: I: 9389983-9390832
• Organism: Caenorhabditis elegans

97 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_N2
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Transcripts that showed significantly decreased expression in FACS sorted neuron cells (labelled by pan-neuronal GFP) from edIs6[unc-119::GFP + rol-6(su1006)]; thoc-5(wy822) comparing to in edIs6.	DESeq2, log2 fold change > 2, adjusted p-value < 0.005.	WBPaper00055103:thoc-5(wy822)_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Germline-intrinsic transcripts.	Comparisons were made between genotypes by subtracting the mean log value of one ratio from another, and the significance of the difference was evaluated using Student t-test for two populations. For the fem-3(gf) versus fem-1(lf) direct comparison, authors performed the same analysis, except they used a Students t-test for one population. Author chose a combination of a twofold difference with a t value exceeding 99% confidence (P < 0.01), because these criteria allowed the inclusion of essentially all genes that had previously been identified as germline-enriched in a wt/glp-4 hermaphrodite comparison. Additionally, requiring a twofold difference reduced false positives, as the number of genes with two-fold difference and a P<0.01 only included ~100 genes more than with P < 0.001, and almost all genes showed germline expression by in situ hybridization.	[cgc6390]:intrinsic
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated
	Transcripts that showed significantly increased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_upregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts unqiuely expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_enriched
	Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVA-neuron_L1-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (Young adult all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:CEP-sheath-cells_Day1-adult_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:intestine_L1-larva_expressed

9 Expression Patterns

• Primary Identifier: Expr5773
• Remark: Strain: BC13691
• Reporter Gene: [F16A11.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGTCACCTTGCATATTATGGG] 3' and primer B 5' [TGCGAGGGATTCTGAATATAAAA] 3'.
• Pattern: Adult Expression: pharynx; vulval muscle; body wall muscle; Larval Expression: pharynx; body wall muscle

• Primary Identifier: Expr1033870
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram686
• Remark: Original chronogram file: chronogram.1715.xml
• Reporter Gene: [F16A11.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2015570
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr12080
• Subcellular Localization: Tagged RtcB was diffusely localized in the nucleus and in the cytoplasm, consistent with its function in tRNA and mRNA ligation. The transgene used is expressing rtcb-1 cDNA behind the intestine-specific spl-1 promoter.

• Primary Identifier: Expr12738
• Pattern: In intestinal cells, RtcB (RTCB-1) was found in both the nucleus and cytoplasm. By contrast, neuronal RtcB was tightly associated with a perinuclear compartment and only weakly present in the remainder of the cell body; little or no RtcB was detectable in neuronal processes.

• Primary Identifier: Expr1148737
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2033805
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1018785
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

30 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00008877
• Start: 9390833
• End: 9393095
• Strand: -1

30 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2263

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00036319
• WBStrain00050273

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_9393096..9393760
• Length (nt): 665
• Chromosome Location: I: 9393096-9393760
• Organism: Caenorhabditis elegans