WormMine: Gene WBGene00009177

• WormBase Gene ID: WBGene00009177
• Gene Name: F26H9.5
• Sequence Name: F26H9.5
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable O-phospho-L-serine:2-oxoglutarate aminotransferase activity and pyridoxal phosphate binding activity. Predicted to be involved in L-serine biosynthetic process. Predicted to be located in cytoplasm. Expressed in head and tail. Human ortholog(s) of this gene implicated in Neu-Laxova syndrome 2 and PSAT deficiency. Is an ortholog of human PSAT1 (phosphoserine aminotransferase 1).
• Biotype: SO:0001217
• Genetic Position: :±
• Length (nt): 2261

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00009177

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F26H9.5.2	F26H9.5.2	1376	I: 9312631-9314891
Transcript:F26H9.5.1	F26H9.5.1	1283	I: 9312635-9314488

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F26H9.5	F26H9.5	1113	I: 9312769-9313314

9 RNAi Result

• WBRNAi00113222
• WBRNAi00045708
• WBRNAi00003492
• WBRNAi00076352
• WBRNAi00116470
• WBRNAi00113162
• WBRNAi00113114
• WBRNAi00082822
• WBRNAi00112992

17 Allele

• gk962858
• gk962706
• gk963902
• gk963849
• gk964316
• gk964127
• gk964128
• gk446940
• gk962040
• gk118516
• gk118517
• WBVar00155732
• gk443478
• gk443477
• gk337421
• gk855723
• gk825647

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00009177
• Start: 9312631
• End: 9314891
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

170 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
	Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults.	Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05.	WBPaper00061530:nhr-49(e2144)_downregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Reduced humidity (98% relative humidity).	Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis.	Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001.	WBPaper00044578:reduced-humidity_downregulated_microarray
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:sek-1(km4)_downregulated_cisplatin
	Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:oscillating_dev_expression
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:germline-precursors_blastula-embryo_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_larva_enriched
	Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_larva_SelectivelyEnriched
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:intestine_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Starvation	Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl)	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:starvation_regulated_LowSalt

7 Expression Patterns

• Primary Identifier: Expr2021266
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5885
• Remark: Also expressed in (comments from author) : No comments Strain: BC11393
• Reporter Gene: [F26H9.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAATTTCCCAATTGCTCTTGA] 3' and primer B 5' [GCGATTTTATGGAGAAGAGGG] 3'.
• Pattern: Adult Expression: intestine; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr1034003
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram285
• Remark: Original chronogram file: chronogram.1308.xml
• Reporter Gene: [F26H9.5:gfp] transcriptional fusion.

• Primary Identifier: Expr1012208
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2003051
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1149620
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

12 GO Annotation

7 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00009177
• Start: 9312631
• End: 9314891
• Strand: -1

12 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2261

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00001743
• WBStrain00001742

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_9314892..9317712
• Length (nt): 2821
• Chromosome Location: I: 9314892-9317712
• Organism: Caenorhabditis elegans