WormMine: Gene WBGene00009242

• WormBase Gene ID: WBGene00009242
• Gene Name: sre-6
• Sequence Name: F28H7.9
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane.
• Biotype: SO:0001217
• Genetic Position: V :2.75642 ±0.000646
• Length (nt): 2221

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00009242

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F28H7.9.1	F28H7.9.1	1189	V: 10760575-10762795

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F28H7.9	F28H7.9	1101	V: 10760658-10760867

2 RNAi Result

• WBRNAi00045886
• WBRNAi00008717

26 Allele

• gk963301
• gk964451
• gk964452
• gk963495
• gk963496
• gk964351
• gk964304
• WBVar01865168
• gk246112
• gk246116
• gk246115
• gk246114
• gk246113
• gk246117
• gk948889
• tm11023
• WBVar01743206
• WBVar01461570
• gk620719
• gk414290
• gk850730
• tm12016
• gk841125
• gk556792
• gk574070
• gk913086

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00009242
• Start: 10760575
• End: 10762795
• Strand: -1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

0 Downstream Intergenic Region

64 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Transcripts that showed significantly decreased expression in hpl-2(tm1489) comparing to in N2 animals.	DESeq2, adjusted p-value < 0.05, log2 fold change > 2 or < -2.	WBPaper00054493:hpl-2(tm1489)_downregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Up-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2.	Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off.	WBPaper00045774:clk-1_upregulated
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
24 hours of AgNPs exposure.	Genes downregulated more than 2 fold after 24 hours of AgNPs exposure.	Statistical differences between the control and exposed worms were determined by a parametric t test, and a Pearson correlation test was performed for correlation analysis, using the Statistical Package for the Social Sciences (SPSS, Chicago, IL).	WBPaper00034661:AgNPs_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-2(e1370)_upregulated_neuron
	Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-16(mu86)_upregulated_neuron
	Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
	Genes that showed significantly decreased expression in daf-19(m86);daf-12(sa204) comparing to in daf-12(sa204), at L1 larva stage.	BRB Array Tools were used to identify genes with statistically significant variation in expression. The probability threshold was set at a maximum of 0.05 (p-value <= 0.05) for genes to be considered statistically differentially expressed in wild-type and mutant populations. Genes with a signal variation of 1.5-fold or greater were selected for subsequent experiments. To reduce false discoveries, a class comparison test was conducted using a multivariate per mutation test with a confidence level of 97% (L1 analysis) and 90% (adults).	WBPaper00053550:daf-19(m86)_downregulated_L1
Fungi infection: Harposporium sp.	Genes with decreased expression after 24 hours of infection by Harposporium Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:Harposporium_24hr_downregulated_RNAseq
moderate static magnetic field	Transcripts that showed significantly decreased expression after exposure to moderate static magnetic field.	N.A.	WBPaper00064509:static-magnetic-field_downregulated
Bacteria infection: Photorhabdus luminescens	Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:P.lumniescens_24hr_upregulated_RNAseq
	siRNAs that showed significantly lower expression (log2fold > 2, padj < 0.01) in hermaphrodite gonad (somatic gonad plus germine) than in male gonad (somatic gonad plus germine).	DESeq2 v1.13.8, fold change > 2, FDR < 0.01.	WBPaper00056161:male_enriched_siRNA
	Genes that showed significantly decreased expression in after 5 hours of 30ug/ml tunicamycin(TM) treatment comparing to control animals.	N.A.	WBPaper00045390:tunicamycin_downregulated
Starvation 2-4 hours at L1 larva stage since hatching.	Genes that showed significantly changed expression by starvation for 2-4 hours after hatch, by comparing N2 starved and N2 fed animals at L1 larva.	Normalized log2 GCRMA values were used to assess significance of expression changes with the LIMMA/GCRMA empirical Bayes test. A threshold for significance at a q-value (FDR) of less than 0.05 was used to determine if a gene is differentially expressed.	WBPaper00053236:Starvation_regulated_N2
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_RNAseq
Bacteria diet: Chryseobacterium sp. CHNTR56 MYb120	Transcripts that showed significantly increased expression after animals were fed by Chryseobacterium sp. CHNTR56 MYb120, comparing to animals fed by OP50.	edgeR FDR <= 0.05, fold change >= 4.	WBPaper00061424:Diet_MYb120_upregulated
	Transcripts that showed significantly increased expression in mex-3(eu149) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	RPKM fold change > 2.	WBPaper00058598:mex-3(eu149)_upregulated
	Transcripts that showed significantly decreased expression in tmc-1(rg1003) comparing to in N2.	DESeq2. The genes with a fold change >= 2 and a false discovery rate (FDR) < 0.05 in a comparison were identified as significant DEGs.	WBPaper00065746:tmc-1(rg1003)_downregulated
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_9

6 Expression Patterns

• Primary Identifier: Expr2034535
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5913
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10849
• Reporter Gene: [F28H7.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGAGCACTTCCCTGAAGGAG] 3' and primer B 5' [CACTGGAAGAACTGATTACCTGAA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; nerve ring; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; tail neurons

• Primary Identifier: Expr1019210
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2016310
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1398
• Remark: Original chronogram file: chronogram.279.xml
• Reporter Gene: [F28H7.9:gfp] transcriptional fusion.

• Primary Identifier: Expr1149790
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

4 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00009242
• Start: 10760575
• End: 10762795
• Strand: -1

4 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2221

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00001540

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_10762796..10764365
• Length (nt): 1570
• Chromosome Location: V: 10762796-10764365
• Organism: Caenorhabditis elegans