WormMine: Gene WBGene00010419

• WormBase Gene ID: WBGene00010419
• Gene Name: atp-1
• Sequence Name: H28O16.1
• Brief Description: H28O16.1 encodes the C. elegans ortholog of the alpha subunit of mitochondrial ATP synthase.
• Organism: Caenorhabditis elegans
• Automated Description: Enables enterobactin binding activity. Involved in iron import into cell. Located in mitochondrion. Expressed in tail. Human ortholog(s) of this gene implicated in combined oxidative phosphorylation deficiency 22; mitochondrial complex V (ATP synthase) deficiency nuclear type 4 (multiple); and vascular dementia. Is an ortholog of human ATP5F1A (ATP synthase F1 subunit alpha).
• Biotype: SO:0001217
• Genetic Position: I :13.879±
• Length (nt): 2379

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00010419

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:H28O16.1a.1	H28O16.1a.1	2031	I: 12652277-12654655

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:H28O16.1a	H28O16.1a	1617	I: 12652390-12652434

29 RNAi Result

• WBRNAi00095662
• WBRNAi00085401
• WBRNAi00025815
• WBRNAi00066299
• WBRNAi00065010
• WBRNAi00090930
• WBRNAi00066165
• WBRNAi00081423
• WBRNAi00066250
• WBRNAi00033765
• WBRNAi00025816
• WBRNAi00000073
• WBRNAi00049517
• WBRNAi00066243
• WBRNAi00112812
• WBRNAi00112932
• WBRNAi00112872
• WBRNAi00084373
• WBRNAi00095864
• WBRNAi00095941
• WBRNAi00096016
• WBRNAi00096093
• WBRNAi00096170
• WBRNAi00096247
• WBRNAi00096342
• WBRNAi00096425
• WBRNAi00096508
• WBRNAi00096606
• WBRNAi00109857

62 Allele

• gk962706
• gk963849
• gk964175
• gk963095
• h4620
• WBVar01433940
• WBVar01433939
• WBVar02121105
• WBVar01932783
• gk882827
• gk337942
• gk653554
• gk644077
• gk381701
• gk455693
• gk880130
• gk391905
• gk391904
• gk323184
• gk561663
• gk880129
• gk559928
• gk841555
• gk489524
• gk757364
• gk897616
• gk383174
• gk856218
• gk881274
• gk328329

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00010419
• Start: 12652277
• End: 12654655
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_12654656..12655013
• Length (nt): 358
• Chromosome Location: I: 12654656-12655013
• Organism: Caenorhabditis elegans

188 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
Bacteria: E.faecalis strain OG1RF	Transcripts that showed significantly increased expression after infection by E. faecalis OG1RF.	Ballgown was used to calculate differential expression of genes using FPKM data and to generate tables with fold change and P values. Genes were shortlisted with a cutoff of 2-fold change and P values of less than 0.05.	WBPaper00059754:E.faecalis_OG1RF_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated

12 Expression Patterns

• Primary Identifier: Expr6287
• Remark: Strain: BC13915
• Reporter Gene: [H28O16.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAATTTGGGGATTCAGGG] 3' and primer B 5' [TCCTCAACGGGTCTGCTC] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis

• Primary Identifier: Expr6288
• Remark: Strain: BC14522
• Reporter Gene: [H28O16.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAATTTGGGGATTCAGGG] 3' and primer B 5' [TCCTCAACGGGTCTGCTC] 3'.
• Pattern: Adult Expression: pharynx; intestine; body wall muscle; unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; unidentified cells in tail

• Primary Identifier: Expr6289
• Remark: Strain: BC15199
• Reporter Gene: [H28O16.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAATTTGGGGATTCAGGG] 3' and primer B 5' [TCCTCAACGGGTCTGCTC] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; body wall muscle; Larval Expression: pharynx; intestine; body wall muscle

• Primary Identifier: Expr1153237
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1034544
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1015503
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram370
• Remark: Original chronogram file: chronogram.1386.xml
• Reporter Gene: [H28O16.1:gfp] transcriptional fusion.

• Primary Identifier: Expr13881
• Pattern: We observed co-localization of ATP-1 with the MitoTracker marker in the intestine, which is consistent with ATP-1 function in mitochondria.

• Primary Identifier: Expr2004590
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2022815
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1609
• Remark: Original chronogram file: chronogram.490.xml
• Reporter Gene: [H28O16.1:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1865
• Remark: Original chronogram file: chronogram.783.xml
• Reporter Gene: [H28O16.1:gfp] transcriptional fusion.

22 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00010419
• Start: 12652277
• End: 12654655
• Strand: 1

22 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2379

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00037556
• WBStrain00002785
• WBStrain00003396
• WBStrain00003081

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_12652088..12652276
• Length (nt): 189
• Chromosome Location: I: 12652088-12652276
• Organism: Caenorhabditis elegans