WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00012375 Gene Name  mecr-1
Sequence Name  ? W09H1.5 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable enoyl-[acyl-carrier-protein] reductase (NADPH) activity. Predicted to be involved in fatty acid metabolic process. Predicted to be located in mitochondrion. Expressed in tail. Human ortholog(s) of this gene implicated in childhood-onset dystonia with optic atrophy and basal ganglia abnormalities and optic atrophy. Is an ortholog of human MECR (mitochondrial trans-2-enoyl-CoA reductase). Biotype  SO:0001217
Genetic Position  II :15.4727 ±0.140746 Length (nt)  ? 1328
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00012375

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:W09H1.5.1 W09H1.5.1 1167   II: 13185987-13187314
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:W09H1.5 W09H1.5 1035   II: 13186078-13186692

7 RNAi Result

WormBase ID
WBRNAi00055074
WBRNAi00019769
WBRNAi00108411
WBRNAi00036424
WBRNAi00108412
WBRNAi00065266
WBRNAi00108410

30 Allele

Public Name
gk963801
gk963053
gk962684
gk962526
gk962527
gk836931
gk828359
gk409789
gk398634
gk372423
gk546004
gk803027
gk720372
gk798042
gk387382
gk394353
gk375604
h12097
WBVar01936489
WBVar01316056
WBVar01316057
WBVar01851767
gk5557
WBVar00238882
WBVar01539495
WBVar00004643
WBVar01561290
WBVar01949747
WBVar01912281
gk158976

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00012375 13185987 13187314 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_13185922..13185986   65 II: 13185922-13185986 Caenorhabditis elegans

97 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  oocyte proteins identified by two or more unique peptides during proteomics study. In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. WBPaper00038289:oocyte_protein
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_oocyte_depleted
  Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells. Log2 Fold change > 2 or <-1, p-value < 0.05. WBPaper00053599:oocyte_vs_mitosis_upregulated
Temprature shift to 28C for 48 hours. Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_48h_downregulated
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
Starvation 48 hours at L1 arrest Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest) Fold change > 2. WBPaper00064005:starvation_upregulated_N2_mRNA
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_downregulated
  Transcripts down regulated in hpl-2(tm1489) embryo comparing to N2 in tiling array analysis. Oligos from the tiling array were mapped to chromosome coordinates of the exons from Wormbase WS180. Any oligo that mapped to a gene on both the Watson and Crick strands was excluded. The remaining oligos were then grouped together (perfect match and mismatch) into probe sets and written out into an Affymetrix CDF file. The CDF file was converted into an R-package and loaded into R. The expression values were calculated using the justRMA function from Bioconductor. This used a Benjamini and Hochberg false discovery rate correction. WBPaper00040560:hpl-2_embryo_downregulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_E
  Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated
  Genes that showed significantly altered expression between N2 and npr-1(ur89) strains exposed to either the nematocidal B. thuringiensis B-18247, the pathogenic P. aeruginosa PA14, or the control E. coli OP50 for 12 or 24 hours. Estimation of transcript abundance and significantly differentially expressed genes were identified by Cuffdiff using the quartile normalization method. Transcripts with a significant change between different conditions (adjusted p-value < 0.01 by the false discovery rate, FDR) were treated as signature for each comparison. WBPaper00049498:npr-1(ur89)_regulated_3
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L1-larva_expressed
heat shock: 33C 30min Transcripts that showed significantly decreased expression in hsf-1(RNAi) animals, after heat shock at 33 C for 30min, comparing to in hsf-1(RNAi) animals without heat shock. Transcripts that were differentially expressed in different conditions, compared to the hsf-1(+);-HS control, were determined with CuffDiff, which uses the Benjamini-Hochberg correction for multiple testing to obtain the q-value (the FDR-adjusted the p-value). WBPaper00049942:HeatShock_downregulated_hsf-1(RNAi)
  Transcripts that showed significantly decreased expression in hsf-1(RNAi) animals comparing to in control animals, without heat shock. Transcripts that were differentially expressed in different conditions, compared to the hsf-1(+);-HS control, were determined with CuffDiff, which uses the Benjamini-Hochberg correction for multiple testing to obtain the q-value (the FDR-adjusted the p-value). WBPaper00049942:hsf-1(RNAi)_downregulated
20C vs 25C Transcripts that showed differential expression in 20C vs 25C in N2 animals at adult stage. N.A. WBPaper00050488:20C_vs_25C_regulated_N2_adult
  Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector. Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples. WBPaper00051039:germline_enriched
  Transcripts that showed significantly decreased expression in sek-1(km4) animals comparing to in N2 animals under both dietary (DR, OP50 OD = 0.1) and ad libtum (AL, OP50 OD = 3) conditions from 3-day post L4 till 6-day post L4 adult hermaphrodite stage. Bioconductor package edgeR, p < 0.05. WBPaper00056443:sek-1(km4)_downregulated
Bacteria infection: Xenorhabdus nematophila Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila. Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets. WBPaper00041606:CE_X.nematophila_regulated

7 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC14459 [W09H1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACAAACAGCAAGAAGGTGG] 3' and primer B 5' [TTAAGATCCGGAATTCGCAC] 3'. Expr6865 Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail ;  
Original chronogram file: chronogram.2366.xml [W09H1.5:gfp] transcriptional fusion. Chronogram1242    
    Expr2013504 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2031738 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1035483 Tiling arrays expression graphs  
    Expr1012395 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1158609 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

9 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  involved_in

6 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00012375 13185987 13187314 -1

9 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
1328

1 Sequence Ontology Term

Identifier Name Description
gene  

3 Strains

WormBase ID
WBStrain00051182
WBStrain00051906
WBStrain00003047

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_13187315..13193695   6381 II: 13187315-13193695 Caenorhabditis elegans