WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00012846 Gene Name  srxa-14
Sequence Name  ? Y44A6B.1 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Expressed in ADLL; ADLR; AIML; and AIMR. Biotype  SO:0001217
Genetic Position  V :25.0286 ±0.000628 Length (nt)  ? 1456
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00012846

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:Y44A6B.1.1 Y44A6B.1.1 960   V: 20639594-20641049
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:Y44A6B.1 Y44A6B.1 960   V: 20639594-20639690

3 RNAi Result

WormBase ID
WBRNAi00056541
WBRNAi00020574
WBRNAi00037068

62 Allele

Public Name
gk963271
WBVar02124844
gk964176
gk962705
gk963489
gk963304
WBVar02122714
WBVar02124642
gk963809
WBVar01756216
WBVar01756217
WBVar01756218
WBVar01756219
WBVar01756220
WBVar01756221
WBVar01756222
WBVar01756223
WBVar01756224
WBVar01756225
WBVar01756226
WBVar01756227
WBVar01756228
WBVar01756229
WBVar01756230
WBVar01756231
WBVar01756232
WBVar01756233
WBVar01756234
WBVar01756235
WBVar01756236

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00012846 20639594 20641049 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_20641050..20642195   1146 V: 20641050-20642195 Caenorhabditis elegans

19 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:sre-33-ZK1025.1_8337
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:eat-2(ad1116)_downregulated
  Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage. DESeq v1.6.3. Fold change > 1.5. WBPaper00050370:dpy-21(e428)_L3_upregulated
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts that interact with 3xFLAG-DLC-1 as identified by immunoprecipitation followed by RNA sequencing. DESeq2, fold change > 2,, p-value < 0.01 WBPaper00055334:DLC-1_interacting
Fungi infection: Drechmeria coniospora Genes with increased expression after 12 hours of infection by D.coniospora Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:D.coniospora_12hr_upregulated_RNAseq
  Transcripts that showed significantly increased expression in hlh-26(ok1453) animals exposed to E. faecium for 8 hours, comparing to N2 animals exposed to E. faecium for 8 hours. Fold change > 2. WBPaper00062585:hlh-26(ok1453)_upregulated_E.faecium
Fungi infection: Harposporium sp. Genes with increased expression after 24 hours of infection by Harposporium Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:Harposporium_24hr_upregulated_RNAseq
  Transcripts that showed significantly decreased expression in swsn-1(os22ts) comparing to in N2 animals at young adult worms. DESeq2, FDR<0.05 and fold-change 2. (Threshold set by WormBase curator.) WBPaper00060764:swsn-1(os22ts)_downregulated
  Transcripts that showed significantly increased expression in FACS sorted neuron cells (labelled by pan-neuronal GFP) from edIs6[unc-119::GFP + rol-6(su1006)]; thoc-5(wy822) comparing to in edIs6. DESeq2, log2 fold change > 2, adjusted p-value < 0.005. WBPaper00055103:thoc-5(wy822)_upregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure. Small RNAs (21-26nt) that showed significantly decreased expression after L4 animals were exposed to P .aeruginosa strain PA14 for 24 hours. DESeq2, FDR < 0.05 WBPaper00056868:P.aeruginosa_downregulated_smallRNA
  mRNAs that showed decreased expression in csr-1(RNAi) animales comparing to in control RNAi animals. Set 1 transcripts were defined as P-value < 0.05 and fold change > 1.9. DESeq was used. Fold change between the average of the four control replicates and the average of the four test replicates was used to calculate the significance using a negative binomial distribution. An adjusted P-value was calculated using the Benjamini-Hochberg method for multiple testing correction. WBPaper00046805:csr-1(RNAi)_downregulated_Set1
  Genes upregulated by wild-type pmk-1 (downregulated in daf-2(e1368);pmk-1(km25) strain as compared to daf-2(e1368) strain) by at least 2 fold and P < 0.01, as determined by a t-test. At least 2 fold and P < 0.01, as determined by a t-test. WBPaper00028789:pmk-1_upregulated
  Transcripts that showed significantly decreased expression in cnd-1(ju29) comparing to in N2. DESeq2 1.16.1 (R3.4.1) WBPaper00059932:cnd-1(ju29)_downregulated

4 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : ADL amphid neuron. Strong and consistent expression in an interneuron that may be AIY. Weaker and less consistent expression in ADL. (Sengupta Lab 2005). Strain: BC14775 [srxa-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTTTTTATGATTGCCTGCC] 3' and primer B 5' [TGATCTCAAAAGAGGTTTCACTG] 3'. Expr6974 Adult Expression: pharynx; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; Larval Expression: pharynx; intestine; rectal gland cells; hypodermis; Nervous System; head neurons;  
    Expr14192 ADL, AIM, hypodermis, gut  
    Expr1020693 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1160015 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00012846 20639594 20641049 1

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1456

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_20638445..20639593   1149 V: 20638445-20639593 Caenorhabditis elegans