WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00012847 Gene Name  srxa-15
Sequence Name  ? Y44A6B.2 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Biotype  SO:0001217
Genetic Position  V :25.0299 ±0.000563 Length (nt)  ? 2185
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00012847

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:Y44A6B.2a.1 Y44A6B.2a.1 1092   V: 20642196-20644380
Transcript:Y44A6B.2b.1 Y44A6B.2b.1 825   V: 20642289-20644356
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:Y44A6B.2a Y44A6B.2a 975   V: 20642289-20642385
CDS:Y44A6B.2b Y44A6B.2b 825   V: 20642289-20642385

6 RNAi Result

WormBase ID
WBRNAi00056542
WBRNAi00020575
WBRNAi00023353
WBRNAi00023866
WBRNAi00024153
WBRNAi00024226

118 Allele

Public Name
gk963271
WBVar02124844
gk964176
gk962705
gk963489
gk963304
WBVar02122714
WBVar02124642
gk963809
WBVar01756327
WBVar01756328
WBVar01756329
WBVar01756330
WBVar01756331
WBVar01756332
WBVar01756333
WBVar01756334
WBVar01756335
WBVar01756336
WBVar01756337
WBVar01756300
WBVar01756301
WBVar01756302
WBVar01756303
WBVar01756304
WBVar01756305
WBVar01756306
WBVar01756307
WBVar01756308
WBVar01756309

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00012847 20642196 20644380 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_20644381..20647600   3220 V: 20644381-20647600 Caenorhabditis elegans

41 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_upregulated
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_18
  Coexpression clique No. 60, 176662_at-Y53F4B.16, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:176662_at-Y53F4B.16
  Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage. EdgeR, fold change > 2, FDR < 0.001. WBPaper00056290:hsp-6(mg585)_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. Student's t-test, fold change > 2, p-value < 0.05. WBPaper00055386:daf-2(e1370)_upregulated
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Transcripts that showed significantly decreased expression after animals grew in 500 uM glycine from hatch till 1-day post L4 adult, comparing to untreated animals. Differential expression was assessed using a nempirical Bayes moderated t-test within limmas linear model framework including the precision weights estimated by voom.Resulting p-values were corrected for multiple testing using the Benjamini-Hochberg false discovery rate. Curator applied threshold: fold change > 2, adjusted p-value < 0.01. WBPaper00056330:glycine_downregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-2(e1370)_upregulated_neuron
  Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-16(mu86)_upregulated_neuron
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
Skin Wounding: skin wounding using femtosecond or Micropoint UV laser or with single stabs of a microinjection needle to the anterior or posterior body 24 h after the L4 stage. Transcripts that showed significantly increased expression after skin wounding using femtosecond or Micropoint UV laser or with single stabs of a microinjection needle to the anterior or posterior body 24 h after the L4 stage of N2 animals. The cutoff for differential expressed genes (DEGs) were: Benjamini-Hochberg adjusted p-value less than 0.05 and fold change larger than 1.5. WBPaper00059895:wounding_upregulated
Bacteria infection: Photorhabdus luminescens Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:P.lumniescens_24hr_upregulated_RNAseq
  Transcripts that showed significantly increased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage. DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. WBPaper00066110:tetraploid_vs_diploid_upregulated
Wounding: 2 hours after a single stab of a microinjection needle to either anterior or posterior body of lateral hyp7 (avoid the gonad) 24 hr after the L4 stage. Transcripts that showed significantly increased expression 2 hours after animals had a single stab of a microinjection needle to either anterior or posterior body of lateral hyp7 (avoid the gonad) 24 hr after the L4 stage. The cutoff for differential expressed genes (DEGs) were: Benjamini-Hochberg adjustedP-valueless than 0.05 and fold change larger than 1.5. WBPaper00059987:Wounding_upregulated
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_RNAseq
Bacteria diet: Chryseobacterium sp. CHNTR56 MYb120 Transcripts that showed significantly increased expression after animals were fed by Chryseobacterium sp. CHNTR56 MYb120, comparing to animals fed by OP50. edgeR FDR <= 0.05, fold change >= 4. WBPaper00061424:Diet_MYb120_upregulated
  Transcripts enriched in invading anchor cells comparing to in whole animal. DESeq2v.1.30.1. fold change >= 2, FDR < 0.05 WBPaper00065258:anchor-cell_enriched
  Transcripts that showed significantly increased expression in mrps-5(RNAi) comparing to in control animals. Fold change > 4, p-value < 0.01 WBPaper00056330:mrps-5(RNAi)_upregulated
  Transcripts that showed significantly increased expression in DLS357 [ceh-60(ok1485)] comparing to in N2 at day 4 adults. DESeq2, fold change > 2, FDR < 0.01. WBPaper00056550:ceh-60(ok1485)_upregulated_AdultDay4
  Transcripts that showed significantly decreased expression in cco-1(RNAi) comparing to in vector control animals. The limma package47 was used for differential expression. Genes with a Benjamini-Hochberg adjusted P-value <0.05 and an absolute log fold change of 2 were considered differentially expressed. WBPaper00053402:cco-1(RNAi)_downregulated
  Transcripts that showed significantly decreased expression in mrps-5(RNAi) animals comparing to animals injected with empty vector. Differential expression was assessed using a Partial least-squares discriminant analysis (PLS-DA) using mixomics setting a variable of importance (VIP) score of greater than 1 as significant. WBPaper00059328:mrps-5(RNAi)_downregulated_mRNA

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2035035 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : ADL + ASJ amphid neurons; PHA phasmid neuron (Hobert Lab 2005). Strain: BC13446 [Y44A6B.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCTGGGTGCATCCTAACA] 3' and primer B 5' [CGATTTTCAAATCCTGCAAAC] 3'. Expr6975 Adult Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; tail neurons; phasmids;  
    Expr1027648 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2016868 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.2388.xml [Y44A6B.2:gfp] transcriptional fusion. Chronogram1265    
    Expr1160016 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00012847 20642196 20644380 1

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
2185

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00002594

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_20641050..20642195   1146 V: 20641050-20642195 Caenorhabditis elegans