WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00012538 Gene Name  semo-1
Sequence Name  ? Y37A1B.5 Organism  Caenorhabditis elegans
Automated Description  Enables methanethiol oxidase activity. Expressed in hypodermal cell. Human ortholog(s) of this gene implicated in glaucoma. Is an ortholog of human SELENBP1 (selenium binding protein 1). Biotype  SO:0001217
Genetic Position  Length (nt)  ? 5518
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00012538

Genomics

3 Transcripts

Class WormMine ID Sequence Name Length (nt) Chromosome Location
MRNA Transcript:Y37A1B.5a.1 Y37A1B.5a.1 1530   IV: 14051200-14056717
NcPrimaryTranscript Transcript:Y37A1B.5c Y37A1B.5c 1881   IV: 14051222-14056625
MRNA Transcript:Y37A1B.5b.1 Y37A1B.5b.1 495   IV: 14055549-14056625
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:Y37A1B.5a Y37A1B.5a 1416   IV: 14051222-14051395
CDS:Y37A1B.5b Y37A1B.5b 495   IV: 14055549-14055880

2 RNAi Result

WormBase ID
WBRNAi00055856
WBRNAi00020206

143 Allele

Public Name
gk964078
gk963546
gk963547
gk964500
gk962765
gk964111
gk964110
gk962794
gk525968
gk707246
gk774603
gk540810
gk523347
gk449320
gk412489
gk728070
gk493739
gk334267
gk417590
gk796146
gk656254
gk503419
gk879192
gk422241
gk765426
gk418571
gk912374
gk728069
gk780500
gk906735

1 Chromosome

WormBase ID Organism Length (nt)
IV Caenorhabditis elegans 17493829  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00012538 14051200 14056717 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_14056718..14059550   2833 IV: 14056718-14059550 Caenorhabditis elegans

296 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector. p-value <= 0.05 WBPaper00066902:cat-1(RNAi)_regulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Developmentally modulated gene cluster. self-organizing map cgc4386_cluster_1_5
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day11_vs_Day1_downregulated
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. edgeR, fold change > 2, FDR < 0.05 WBPaper00060909:atfs-1(cmh15)_downregulated
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  mRNAs that showed differential expression in activated AAK-2(uthIs202[aak-2 (intron 1)::aak-2(aa1-aa321)::Tomato::unc-54 3'UTR + rol-6(su1006)]), activiated CRTC-1 (uthEx222[crtc-1p::crtc-1 cDNA (S76S, S179A)::tdTomato::unc-54 3'UTR + rol-6(su1006)]), or AAK-2;CRTC-1 comparing to in N2. Genes were tested for differential expression between each mutant strain and wild-type using edgeRs glm method. Briefly, negative binomial models were fitted and dispersion estimates obtained. These were then used to calculate average levels of change between conditions and determine differential expression, using the generalized linear model likelihood ratio test. For each comparison, genes with less than 5 CPM were filtered and those with at least 50% change and False Discovery Rate (FDR) of 1% or less were considered differentially expressed. WBPaper00046499:AMPK_regulated
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:S.aureus-4h_upregulated_N2
  Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
  Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_N2-background
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated

11 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC12890 [Y37A1B.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACTTTATTAGACGTCGCAATTT] 3' and primer B 5' [TGGGGAGATTTTGGTTTTTG] 3'. Expr6930 Adult Expression: hypodermis; Larval Expression: hypodermis;  
Strain: BC11337 [Y37A1B.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACTTTATTAGACGTCGCAATTT] 3' and primer B 5' [TGGGGAGATTTTGGTTTTTG] 3'. Expr6929 Adult Expression: hypodermis; Larval Expression: hypodermis;  
    Expr14887 Microscopic analysis of adult transgenic worms shows that Y37A1B.5::GFP fluorescence is most prominent in hypodermal cells. Sporadically, in few worms only, GFP fluorescence is also detected in some anterior or posterior intestinal cells. Microscopic analysis of adult transgenic worms shows that Y37A1B.5::GFP fluorescence is most prominent in hypodermal cells.  
    Expr16480 In adult C. elegans, SEMO-1 is localized predominantly to the hypodermis, as seen in worms expressing GFP-labeled SEMO-1.  
    Expr1022141 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1035547 Tiling arrays expression graphs  
    Expr2025466 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr14888   Subcellularly, Y37A1B.5:GFP is found predominantly in the cytoplasm, which is true also for human SELENBP1.
Original chronogram file: chronogram.361.xml [Y37A1B.5:gfp] transcriptional fusion. Chronogram1486    
    Expr1159385 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2007236 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

2 GO Annotation

Annotation Extension Qualifier
  enables
  enables

6 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00012538 14051200 14056717 1

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables

2 Regulates Expr Cluster

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Y37A1B.5(RNAi) comparing to N2 animals injected with empty vector at young adult stage. DESeq2 v1.16.1, fold change > 2, adjusted p-value < 0.05. WBPaper00058648:Y37A1B.5(RNAi)_upregulated
  Transcripts that showed significantly decreased expression in Y37A1B.5(RNAi) comparing to N2 animals injected with empty vector at young adult stage. DESeq2 v1.16.1, fold change > 2, adjusted p-value < 0.05. WBPaper00058648:Y37A1B.5(RNAi)_downregulated

1 Sequence

Length
5518

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00001724

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_14050922..14051199   278 IV: 14050922-14051199 Caenorhabditis elegans