WormMine: Gene WBGene00015232

• WormBase Gene ID: WBGene00015232
• Gene Name: B0511.6
• Sequence Name: B0511.6
• Brief Description: B0511.6 encodes a DEAD-box helicase; loss of B0511.6 activity via RNAi indicates that B0511.6 activity is required for larval development.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable several functions, including ATP binding activity; ATP hydrolysis activity; and RNA helicase activity. Predicted to be involved in maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA). Predicted to be located in nucleolus. Expressed in head and tail. Is an ortholog of human DDX18 (DEAD-box helicase 18).
• Biotype: SO:0001217
• Genetic Position: :±
• Length (nt): 3000

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00015232

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:B0511.6.1	B0511.6.1	1806	I: 10625388-10628387

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:B0511.6	B0511.6	1635	I: 10625395-10625706

13 RNAi Result

• WBRNAi00066211
• WBRNAi00039148
• WBRNAi00094116
• WBRNAi00022269
• WBRNAi00102166
• WBRNAi00087702
• WBRNAi00066141
• WBRNAi00066256
• WBRNAi00024413
• WBRNAi00024414
• WBRNAi00075475
• WBRNAi00117175
• WBRNAi00066231

27 Allele

• gk962858
• gk962706
• gk963902
• gk963849
• WBVar01662796
• gk571811
• WBVar00156545
• gk317506
• gk583465
• gk564417
• gk787078
• gk347232
• gk809620
• gk877871
• gk711581
• gk735132
• gk517191
• gk609480
• gk357157
• gk121048
• gk121049
• gk121050
• gk884714
• ok2948
• gk355779
• gk121051
• WBVar02016373

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00015232
• Start: 10625388
• End: 10628387
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_10628388..10628742
• Length (nt): 355
• Chromosome Location: I: 10628388-10628742
• Organism: Caenorhabditis elegans

131 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:oocyte_vs_mitosis_upregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after N2 animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_N2
	Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals.	Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed.	WBPaper00062193:skn-1(RNAi)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Proteins interacting with HA-PPM-1.D.	N.A.	WBPaper00062498:PPM-1.D_interacting
	Genes regulated by DPY-21, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12.	Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons.	WBPaper00050801:DPY-21_dauer_regulome
Starvation 48 hours at L1 arrest	Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest)	Fold change > 2.	WBPaper00064005:starvation_upregulated_N2_mRNA
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated

7 Expression Patterns

• Primary Identifier: Expr5081
• Remark: Strain: BC10162
• Reporter Gene: [B0511.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCACCTCTCGAGTTCGCATT] 3' and primer B 5' [TGACGTCAATGCCGATTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; hypodermis; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; hypodermis; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr1019860
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1036523
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2018450
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2000230
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1143304
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram2048
• Remark: Original chronogram file: chronogram.957.xml
• Reporter Gene: [B0511.6:gfp] transcriptional fusion.

13 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00015232
• Start: 10625388
• End: 10628387
• Strand: 1

13 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3000

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00037234

0 Upstream Intergenic Region