WormMine: Gene WBGene00014095

• WormBase Gene ID: WBGene00014095
• Gene Name: gdh-1
• Sequence Name: ZK829.4
• Brief Description: gdh-1 encodes a glutamate dehydrogenase, required in mass RNAi assays for normal fertility and rapid growth, that is expressed in larval and adult pharynx, intestine, and rectal gland cells; GDH-1 is orthologous to human GLUD1 (OMIM:138130, mutated in hyperinsulinemic hypoglycemia and hyperammonemia) and GLUD2 (OMIM:300144).
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable glutamate dehydrogenase (NAD+) activity. Predicted to be involved in glutamate catabolic process. Predicted to be located in mitochondrion. Expressed in head; intestine; pharynx; rectal gland cell; and tail. Human ortholog(s) of this gene implicated in Alzheimer's disease; familial hyperinsulinemic hypoglycemia 6; and hyperinsulinism. Is an ortholog of human GLUD1 (glutamate dehydrogenase 1).
• Biotype: SO:0001217
• Genetic Position: IV :5.45243 ±0.000619
• Length (nt): 2293

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00014095

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZK829.4.2	ZK829.4.2	1756	IV: 11953249-11955521
Transcript:ZK829.4.1	ZK829.4.1	1941	IV: 11953249-11955541

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK829.4	ZK829.4	1611	IV: 11953252-11953527

17 RNAi Result

• WBRNAi00095837
• WBRNAi00059750
• WBRNAi00073445
• WBRNAi00073447
• WBRNAi00073446
• WBRNAi00111131
• WBRNAi00038456
• WBRNAi00095917
• WBRNAi00095994
• WBRNAi00096069
• WBRNAi00096146
• WBRNAi00096223
• WBRNAi00096300
• WBRNAi00096398
• WBRNAi00096481
• WBRNAi00096564
• WBRNAi00096663

38 Allele

• gk964278
• gk964078
• gk964500
• gk962765
• gk964475
• gk964320
• gk962528
• h12942
• gk213705
• gk213706
• gk213704
• gk687647
• gk359786
• WBVar01454395
• gk360265
• gk474282
• gk337112
• gk611795
• gk708917
• gk524369
• gk517492
• gk691341
• yq275
• gk730933
• gk213707
• gk540189
• gk213708
• WBVar01454394
• WBVar02114999
• WBVar02114998

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00014095
• Start: 11953249
• End: 11955541
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_11955542..11956476
• Length (nt): 935
• Chromosome Location: IV: 11955542-11956476
• Organism: Caenorhabditis elegans

242 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq.	DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison.	WBPaper00045934:wrn-1(gk99)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Developmentally modulated gene cluster.	self-organizing map	cgc4386_cluster_1_5
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts that showed significantly decreased expression in adbp-1(qj1) comparing to in N2 animals at L4 larva stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00067079:adbp-1(qj1)_downregulated_L4
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day7_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS).	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day7_vs_Day1_downregulated_Nanopore
	Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day10_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS).	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day10_vs_Day1_downregulated_Nanopore

9 Expression Patterns

• Primary Identifier: Expr1163175
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr7259
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC12996
• Reporter Gene: [ZK829.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAGCTCACGTTTTATCATTCTTG] 3' and primer B 5' [GAAAGAGTGCTCAAGATTACCTGA] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal gland cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr7260
• Remark: Strain: BC10871
• Reporter Gene: [ZK829.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAGCTCACGTTTTATCATTCTTG] 3' and primer B 5' [GAAAGAGTGCTCAAGATTACCTGA] 3'.
• Pattern: Adult Expression: pharynx; intestine; Larval Expression: pharynx; intestine

• Primary Identifier: Expr1036313
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram204
• Remark: Original chronogram file: chronogram.1232.xml
• Reporter Gene: [ZK829.4:gfp] transcriptional fusion.

• Primary Identifier: Expr1013000
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2030242
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2012006
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr14639
• Subcellular Localization: Expression of mCherry-tagged SLC-25A18.1 and GDH-1 indicated that they localized to mitochondria.

9 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00014095
• Start: 11953249
• End: 11955541
• Strand: 1

9 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2293

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00055460
• WBStrain00002442
• WBStrain00001547

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_11952209..11953248
• Length (nt): 1040
• Chromosome Location: IV: 11952209-11953248
• Organism: Caenorhabditis elegans