WormMine: Gene WBGene00017973

• WormBase Gene ID: WBGene00017973
• Gene Name: ift-81
• Sequence Name: F32A6.2
• Brief Description: ift-81 encodes an ortholog of the intraflagellar transport component IFT-81 in Chlamydomonas; ift-81 along with ift-74 is involved in growth, chemotaxis, intraflagellar transport and the morphogenesis of cilia; ift-81 binds ift-74 in protein binding assays and co-localizes with ift-74 to the transition zone of cilia in neurons, indicating that ift-81 may form a complex with ift-74.
• Organism: Caenorhabditis elegans
• Automated Description: Enables microtubule binding activity. Involved in chemotaxis; detection of stimulus involved in sensory perception; and intraciliary transport. Located in non-motile cilium. Expressed in amphid neurons; chemosensory neurons; and phasmid neurons. Human ortholog(s) of this gene implicated in short-rib thoracic dysplasia 19 with or without polydactyly. Is an ortholog of human IFT81 (intraflagellar transport 81).
• Biotype: SO:0001217
• Genetic Position: X :-5.72774 ±0.007898
• Length (nt): 7982

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00017973

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F32A6.2.1	F32A6.2.1	2256	X: 5298561-5306542

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F32A6.2	F32A6.2	1917	X: 5298750-5298880

4 RNAi Result

• WBRNAi00046081
• WBRNAi00046082
• WBRNAi00014197
• WBRNAi00031647

143 Allele

• gk964260
• gk962636
• otn12621
• WBVar02063775
• WBVar02063774
• WBVar02063777
• WBVar02063776
• WBVar02063779
• WBVar02063778
• WBVar01758319
• WBVar01758320
• WBVar01758321
• gk517
• WBVar00078916
• WBVar02027084
• WBVar02027085
• WBVar02027082
• WBVar02027083
• WBVar01549768
• WBVar01549769
• WBVar01549774
• WBVar01549772
• WBVar01549773
• WBVar01549770
• WBVar01549771
• WBVar02044944
• WBVar01819854
• qj23
• h13817
• gk866340

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00017973
• Start: 5298561
• End: 5306542
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_5306543..5307485
• Length (nt): 943
• Chromosome Location: X: 5306543-5307485
• Organism: Caenorhabditis elegans

197 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
	Single-cell RNA-Seq cell group 84_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:84_0
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts enriched in ASG according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:ASG_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Single-cell RNA-Seq cell group 71_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:71_0
Bacteria: E.faecalis strain OG1RF	Transcripts that showed significantly increased expression after infection by E. faecalis OG1RF.	Ballgown was used to calculate differential expression of genes using FPKM data and to generate tables with fold change and P values. Genes were shortlisted with a cutoff of 2-fold change and P values of less than 0.05.	WBPaper00059754:E.faecalis_OG1RF_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Top 300 transcripts enriched in ABalppppppa, ABpraaapppa according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:ASE_parent
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage.	DESeq v1.6.3. Fold change > 1.5.	WBPaper00050370:dpy-21(e428)_L3_upregulated

8 Expression Patterns

• Primary Identifier: Expr4638
• Pattern: Expressed exclusively within ciliated cells.

• Primary Identifier: Expr5927
• Remark: Also expressed in (comments from author) : No comments. Strain: BC13261
• Reporter Gene: [F32A6.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACATGATTGTTTATTCAGGGTGTG] 3' and primer B 5' [AAGGATACACCGTTAGTGATGACA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; tail neurons; Larval Expression: Nervous System; head neurons; tail neurons

• Primary Identifier: Expr8322
• Remark: Picture: Figure 3.
• Pattern: The punctuate fluorescent signals were observed in the cell bodies of the head and tail neurons. These signals were detected in all of the dye-filling assay positive cells, suggesting that IFT-81 is expressed in ADL, ASH, ASI, ASJ, ASK, AWB, PHA, PHB ciliary sensory neurons.
• Subcellular Localization: Co-expression analysis was performed using IFT-81-DsRed and OSM-6-venus. OSM-6 is a member of IFT subcomplex B, and known to be expressed in all of the ciliated neurons except the BAG and FLP neurons. The fluorescent signals of DsRed and venus were observed in the cell body of almost the same cells. In these cells, subset of OSM-6-venus overlapped with IFT-81-DsRed signals. These results suggest that IFT-81 is expressed in almost all of the ciliated sensory neurons. Co-distribution of IFT-81-DsRed and OSM-6-venus was also observed at the transition zone at the base of cilia in amphid and phasmid neurons.

• Primary Identifier: Expr1037733
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2012699
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1026677
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2030935
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1149971
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

17 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00017973
• Start: 5298561
• End: 5306542
• Strand: 1

17 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 7982

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00036344
• WBStrain00036504
• WBStrain00051699
• WBStrain00002530
• WBStrain00007576

0 Upstream Intergenic Region