WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00018558 Gene Name  srt-20
Sequence Name  ? F47D2.7 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Expressed in ASIL; ASIR; ASJL; and ASJR. Biotype  SO:0001217
Genetic Position  V :-6.08826 ±0.012978 Length (nt)  ? 2861
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00018558

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F47D2.7a.1 F47D2.7a.1 1214   V: 4275975-4278835
Transcript:F47D2.7b.1 F47D2.7b.1 1005   V: 4276034-4278691
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F47D2.7a F47D2.7a 1011   V: 4276034-4276167
CDS:F47D2.7b F47D2.7b 1005   V: 4276034-4276167

4 RNAi Result

WormBase ID
WBRNAi00047652
WBRNAi00047653
WBRNAi00012187
WBRNAi00015191

62 Allele

Public Name
gk963301
gk963591
gk963553
gk964259
gk964351
gk963850
WBVar01587962
gk964431
gk756258
gk560735
gk472807
gk926556
gk774074
gk845684
gk420327
gk412735
gk743646
WBVar01650262
WBVar01650263
WBVar01650264
WBVar02023444
gk948141
otn13344
otn13343
WBVar02121261
gk963023
WBVar02124231
h3143
WBVar02031913
WBVar02122023

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00018558 4275975 4278835 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_4273330..4275974   2645 V: 4273330-4275974 Caenorhabditis elegans

22 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
Reduced humidity (98% relative humidity). Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis. Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001. WBPaper00044578:reduced-humidity_downregulated_microarray
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
  Transcripts that showed significantly altered expression after 24 hour exposure to nitroguanidine (NQ). Multivariate permutation tests with random variance model implemented in BRB-Array Tools version 4.5 were performed to infer differentially expressed genes (DEGs). One thousand random permutations were computed per chemical class (i.e., a group of 16 arrays or samples). The confidence level of false discovery rate assessment was set at 80%, and the maximum allowed portion of false-positive genes was 10%. WBPaper00055899:nitroguanidine_regulated
  Transcripts down regulated in hpl-2(tm1489) embryo comparing to N2 in tiling array analysis. Oligos from the tiling array were mapped to chromosome coordinates of the exons from Wormbase WS180. Any oligo that mapped to a gene on both the Watson and Crick strands was excluded. The remaining oligos were then grouped together (perfect match and mismatch) into probe sets and written out into an Affymetrix CDF file. The CDF file was converted into an R-package and loaded into R. The expression values were calculated using the justRMA function from Bioconductor. This used a Benjamini and Hochberg false discovery rate correction. WBPaper00040560:hpl-2_embryo_downregulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
  Transcripts that showed significantly lower expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:hmc_biased
  Transcripts that showed differential expression in dauer N2 vs dauer mir-34(gk437) animals at 20C. N.A. WBPaper00050488:N2_vs_mir-34(gk437)_regulated_dauer_20C
  Transcripts that did not alter expression in smg-1(r910) and smg-1(r910) smg-2(r915) mutants comparing to in N2, but their mRNAs co-purify with SMG-2. edgeR WBPaper00053308:SMG-2_associated_NMD(-)_unaltered_ClassII
  Down-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. WBPaper00045774:clk-1_downregulated
  Transcripts that showed significantly decreased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_downregulated_neuron
  Transcripts that showed significantly increased expression in lpd-3(ok2138) comparing to in N2 animals. DESeq2, fold change > 4, FDR < 0.05. WBPaper00064661:lpd-3(ok2138)_upregulated
  Transcripts that showed significantly increased expression in drh-3(rrr2) comparing to in N2. edgeR, log2 fold change > 2 or < -2. WBPaper00053888:drh-3(rrr2)_upregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 4 hours at 25C. Transcripts that showed significantly decreased expression after N2 L4 animals were infected by P. aeruginosa (PA14) bacteria for 4 hours at 25C, comparing to N2 animals grown in OP50. DESeq2 WBPaper00056275:P.aeruginosa_downregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 4 hours at 25C. Transcripts that showed significantly decreased expression after N2 L4 animals were infected by P. aeruginosa (PA14) bacteria for 4 hours at 25C, but atf-7(qd22qd130) animals showed reduced fold change after they went through the same infection. DESeq2 WBPaper00056275:P.aeruginosa_downregulated_atf-7(qd22qd130)_dependent
Bacteria infection: Pseudomonas aeruginosa PA14. 4 hours at 25C. Transcripts that showed significantly decreased expression after N2 L4 animals were infected by P. aeruginosa (PA14) bacteria for 4 hours at 25C, but pmk-1(km25) animals showed reduced fold change after they went through the same infection. DESeq2 WBPaper00056275:P.aeruginosa_downregulated_pmk-1(km25)_dependent
Space flight. Genes decreased to less than half expressionin the spaceflight relative to the ground control. Genes increased by more than 2 fold expression in the spaceflight relative to the ground control are regarded as differentially expressed. WBPaper00041267:SpaceFlight_Downregulated
  Genes that showed significantly increased expression in daf-19(m86);daf-12(sa204) comparing to in daf-12(sa204), at L1 larva stage. BRB Array Tools were used to identify genes with statistically significant variation in expression. The probability threshold was set at a maximum of 0.05 (p-value <= 0.05) for genes to be considered statistically differentially expressed in wild-type and mutant populations. Genes with a signal variation of 1.5-fold or greater were selected for subsequent experiments. To reduce false discoveries, a class comparison test was conducted using a multivariate per mutation test with a confidence level of 97% (L1 analysis) and 90% (adults). WBPaper00053550:daf-19(m86)_upregulated_L1

5 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034844 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : ASH, ASI, + ASJ amphid neurons. Saw gfp in 4 tail cells, one of which is a neuron that sends a long axon anteriorly (PVT?). Additionally, gfp in one other non-DiI stained head neuron pair. (Hobert Lab 2005). Strain: BC14755 [srt-20::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTGGTCACTTGATTTTTAGGAA] 3' and primer B 5' [GGATCTGAAAAATAAGTTCGGCT] 3'. Expr6106 Adult Expression: intestine; rectal gland cells; anal depressor muscle; body wall muscle; Nervous System; head neurons; tail neurons; Larval Expression: intestine; rectal gland cells; anal depressor muscle; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons;  
    Expr14146 ASI, ASJ, sometimes a couple more head neurons, body wall muscle  
    Expr1151499 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2016655 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00018558 4275975 4278835 -1

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
2861

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00003204

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_4278836..4279847   1012 V: 4278836-4279847 Caenorhabditis elegans