WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00017659 Gene Name  F21C10.10
Sequence Name  ? F21C10.10 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable NAD+ binding activity. Predicted to be involved in fatty acid metabolic process. Located in mitochondrion. Biotype  SO:0001217
Genetic Position  Length (nt)  ? 954
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00017659

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F21C10.10.1 F21C10.10.1 776   V: 9096267-9097220
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F21C10.10 F21C10.10 681   V: 9096270-9096324

5 RNAi Result

WormBase ID
WBRNAi00001668
WBRNAi00045170
WBRNAi00013657
WBRNAi00031203
WBRNAi00094996

22 Allele

Public Name
gk963301
gk964351
gk962860
gk964052
gk963442
gk963441
gk963163
WBVar02024120
gk242605
gk242604
gk242603
gk760768
gk704127
gk386615
gk781443
gk917205
gk826554
gk890202
gk436915
gk674020
gk497747
gk568480

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00017659 9096267 9097220 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

346 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C. DESeq2, fold change > 2, p-value < 0.05. WBPaper00061753:csr-1(tor159)_upregulated_25C
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Genes that were upregulated in lin-15B(n744). For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. WBPaper00038168:lin-15B(n744)_upregulated
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
  Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. DESeq2(v1.32.0), FDR < 0.05. WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
starvation 12 hours Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals. EdgeR, FDR < 0.05, fold change >= 2. WBPaper00067259:starvation_upregulated_intestine
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:S.aureus-4h_upregulated_N2
Bacteria infection: Staphylococcus aureus Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen. DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated
Bacteria infection: Staphylococcus aureus Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen. DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
  Transcripts that showed significantly increased expression at the intestine cells of daf-2(e1370) comparing to the intestine cells of N2 animals at L2 larva stage. DESeq2 (version 1.24.0), fold change >= 2, FDR < 0.05 WBPaper00064632:daf-2(e1370)_upregulated_intestine
  Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
  Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_N2-background

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2021025 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
  The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http://www.addgene.org/pgvec1?f=3Dc&cmd=3Dshowcol&colid=3D 1) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70=961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1 ::ORF::GFP expression clones. Expr9521   Sub-cellular localization within the body wall muscle: Mitochondria
    Expr1037580 Tiling arrays expression graphs  
    Expr1149108 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1017247 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2002808 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

3 GO Annotation

Annotation Extension Qualifier
part of(WBbt:0006804) located_in
  involved_in
  enables

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00017659 9096267 9097220 1

3 Ontology Annotations

Annotation Extension Qualifier
part of(WBbt:0006804) located_in
  involved_in
  enables

0 Regulates Expr Cluster

1 Sequence

Length
954

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_9094358..9096266   1909 V: 9094358-9096266 Caenorhabditis elegans