WormMine: Gene WBGene00017304

• WormBase Gene ID: WBGene00017304
• Gene Name: nmad-1
• Sequence Name: F09F7.7
• Organism: Caenorhabditis elegans
• Automated Description: Enables broad specificity oxidative DNA demethylase activity. Involved in several processes, including meiotic chromosome condensation; positive regulation of double-strand break repair; and positive regulation of reproductive process. Predicted to be located in contractile ring and midbody. Expressed in muscle cell. Is an ortholog of human ALKBH4 (alkB homolog 4, lysine demethylase).
• Biotype: SO:0001217
• Genetic Position: III :-1.54934±
• Length (nt): 1446

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00017304

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F09F7.7a.1	F09F7.7a.1	974	III: 5553489-5554934
Transcript:F09F7.7b.1	F09F7.7b.1	627	III: 5554127-5554916

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F09F7.7a	F09F7.7a	876	III: 5553569-5553854
CDS:F09F7.7b	F09F7.7b	627	III: 5554127-5554393

7 RNAi Result

• WBRNAi00044164
• WBRNAi00013003
• WBRNAi00005260
• WBRNAi00030723
• WBRNAi00000792
• WBRNAi00082381
• WBRNAi00111927

31 Allele

• gk964518
• gk174958
• gk174957
• gk174955
• gk174956
• gk964216
• gk964217
• gk964338
• gk964339
• WBVar02069608
• WBVar01263732
• WBVar01263734
• WBVar01263733
• WBVar01445796
• gk955292
• gk958855
• ok3133
• gk903569
• gk802189
• gk853557
• gk442031
• gk440098
• gk369975
• gk759112
• gk830169
• WBVar01817891
• WBVar01999609
• WBVar00060837
• WBVar00060842
• WBVar01995244

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00017304
• Start: 5553489
• End: 5554934
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_5552136..5553488
• Length (nt): 1353
• Chromosome Location: III: 5552136-5553488
• Organism: Caenorhabditis elegans

213 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression in pri-1(RNAi) animals comparing to in N2 animals fed with empty vector.	Differential expression analysis was performed quasi-likelihood F-test with the generalized linear model (GLM) approach in edgeR ver 3.32.1. FDR < 0.05, fold change > 2.	WBPaper00066418:pri-1(RNAi)_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in hda-1(RNAi) embryos comparing to control animals.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00067044:hda-1(RNAi)_upregulated
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
starvation 12 hours	Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals.	EdgeR, FDR < 0.05, fold change >= 2.	WBPaper00067259:starvation_upregulated_intestine
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed signifcantly increased expression in pabp-2(RNAi) animals comparing to in N2 animals injected with empty vector at L1 larva stage and collected at L4 larva stage.	FDR < 0.05, fold change > 2	WBPaper00067368:pabp-2(RNAi)_upregulated_N2
	Transcripts that showed significantly increased expression in rsks-1(ok1255) animals after 4 hours of feeding of starvation-induced arrested L1, comparing to N2 animals that went through the same treatment.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00067518:rsks-1(ok1255)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted

7 Expression Patterns

• Primary Identifier: Expr2020574
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5704
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16164
• Reporter Gene: [F09F7.7a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAACGAAGCATAATCGGCAT] 3' and primer B 5' [GTTCTGCGGAACCGATGT] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; rectal epithelium; body wall muscle; hypodermis; seam cells; Larval Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; rectal epithelium; body wall muscle; hypodermis; seam cells

• Primary Identifier: Expr10729

• Primary Identifier: Expr1037438
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2002356
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1018326
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1148126
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

30 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00017304
• Start: 5553489
• End: 5554934
• Strand: -1

30 Ontology Annotations

5 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed siginificantly increased expression in nmad-1(ok3133) comparing to in N2 at 25 entigrade.	edgeR, FDR < 0.05, fold change > 2.	WBPaper00056997:nmad-1(ok3133)_upregulated_germline_25C
	Transcripts that showed siginificantly decreased expression in nmad-1(ok3133) comparing to in N2 at 25 entigrade.	edgeR, FDR < 0.05, fold change > 2.	WBPaper00056997:nmad-1(ok3133)_downregulated_germline_25C
	Proteins that interact with NMAD-1 according to both GFP and FLAG immunoprecipiation followed with mass spectrometry.	N.A.	WBPaper00056997:NMAD-1_interacting
	Transcripts that showed siginificantly increased expression in nmad-1(ok3133) comparing to in N2 at 20 entigrade.	edgeR, FDR < 0.05, fold change > 2.	WBPaper00056997:nmad-1(ok3133)_upregulated_germline_20C
	Transcripts that showed siginificantly decreased expression in nmad-1(ok3133) comparing to in N2 at 20 entigrade.	edgeR, FDR < 0.05, fold change > 2.	WBPaper00056997:nmad-1(ok3133)_downregulated_germline_20C

1 Sequence

• Length: 1446

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00037403

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_5554935..5555449
• Length (nt): 515
• Chromosome Location: III: 5554935-5555449
• Organism: Caenorhabditis elegans