WormMine: Gene WBGene00019487

• WormBase Gene ID: WBGene00019487
• Gene Name: ephx-1
• Sequence Name: K07D4.7
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity. Expressed in anchor cell; anterior distal tip cell; head; posterior distal tip cell; and uterine toroidal epithelial cell. Is an ortholog of human ARHGEF16 (Rho guanine nucleotide exchange factor 16) and ARHGEF26 (Rho guanine nucleotide exchange factor 26).
• Biotype: SO:0001217
• Genetic Position: II :-5.73088 ±0.03631
• Length (nt): 11168

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00019487

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:K07D4.7a.1	K07D4.7a.1	3792	II: 4004914-4016081
Transcript:K07D4.7c.1	K07D4.7c.1	3060	II: 4007908-4015769
Transcript:K07D4.7d.1	K07D4.7d.1	2079	II: 4011013-4015769
Transcript:K07D4.7b.1	K07D4.7b.1	1947	II: 4012521-4015769

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:K07D4.7a	K07D4.7a	3480	II: 4004914-4005017
CDS:K07D4.7b	K07D4.7b	1947	II: 4012521-4013218
CDS:K07D4.7c	K07D4.7c	3060	II: 4007908-4008678
CDS:K07D4.7d	K07D4.7d	2079	II: 4011013-4011073

5 RNAi Result

• WBRNAi00050160
• WBRNAi00034073
• WBRNAi00016724
• WBRNAi00070658
• WBRNAi00070659

202 Allele

• gk963801
• gk963053
• h10857
• h7757
• h11888
• otn10811
• WBVar01369973
• WBVar01437284
• WBVar01437282
• WBVar01437286
• WBVar01719448
• WBVar01719449
• WBVar01719451
• WBVar01719450
• otn14100
• WBVar01934476
• WBVar01934475
• WBVar01934478
• WBVar01934477
• WBVar01766160
• gk309
• ttTi4309
• gk139757
• gk139761
• gk139760
• gk139759
• gk139758
• gk139763
• gk139762
• gk139739

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00019487
• Start: 4004914
• End: 4016081
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_4016082..4016306
• Length (nt): 225
• Chromosome Location: II: 4016082-4016306
• Organism: Caenorhabditis elegans

104 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
	Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:oscillating_dev_expression
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_downregulated
Fungi infection: Haptoglossa zoospora.	Transcripts that showed significantly altered expression after L4 N2 animals were exposed to omycete Haptoglossa zoospora for 6 hours.	Kalisto abundance files were converted and analysed using Sleuth in a R pipeline. Standard Sleuth protocols were used to calculate differential expression. P value < 0.01 and FDR < 0.01.	WBPaper00062354:H.zoospora_6h_regulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Up-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2.	Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off.	WBPaper00045774:clk-1_upregulated
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated

10 Expression Patterns

• Primary Identifier: Expr6347
• Remark: Strain: BC14586
• Reporter Gene: [tag-218::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTATGGGGATGATTGGAGC] 3' and primer B 5' [TTCCGTGTCGGAGATTACAAC] 3'.
• Pattern: Adult Expression: arcade cells; Reproductive System; uterus; spermatheca; unidentified cells in head; Larval Expression: arcade cells; Reproductive System; developing uterus; developing spermatheca; hypodermis; unidentified cells in head

• Primary Identifier: Expr8756
• Remark: No detailed description on expression pattern in other tissue or life stages.. Picture: Fig 1K, Fig 3.
• Pattern: Expressed in AC and DTC at L3 stage. Expressed in uterine epithelium and spermathecal epithelium at L4 stage.

• Primary Identifier: Expr8755
• Remark: No detailed description on expression pattern in other tissue or life stages.. Picture: Fig 3.
• Pattern: Expressed in somatic primodium at L2 stage. Expressed in VU/DU and AC at L3 stage. Expressed in uterine epithelium and spermathecal epithelium at L4 stage.

• Primary Identifier: Expr2011349
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1153854
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1038420
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2029585
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1028336
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1963
• Remark: Original chronogram file: chronogram.880.xml
• Reporter Gene: [K07D4.7:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1934
• Remark: Original chronogram file: chronogram.854.xml
• Reporter Gene: [K07D4.7:gfp] transcriptional fusion.

2 GO Annotation

20 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00019487
• Start: 4004914
• End: 4016081
• Strand: 1

2 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 11168

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00031449
• WBStrain00036001
• WBStrain00048333
• WBStrain00003111

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_3996083..4004913
• Length (nt): 8831
• Chromosome Location: II: 3996083-4004913
• Organism: Caenorhabditis elegans