WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00018556 Gene Name  srt-36
Sequence Name  ? F47D2.5 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Expressed in ASIL and ASIR. Biotype  SO:0001217
Genetic Position  V :-6.1841 ±0.007089 Length (nt)  ? 1939
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00018556

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F47D2.5.1 F47D2.5.1 984   V: 4266375-4268313
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F47D2.5 F47D2.5 984   V: 4266375-4266644

5 RNAi Result

WormBase ID
WBRNAi00015193
WBRNAi00015195
WBRNAi00047659
WBRNAi00047660
WBRNAi00032442

35 Allele

Public Name
gk963301
gk963591
gk963553
gk964259
gk964351
gk963850
gk964431
gk412734
gk612568
gk762539
gk365025
gk444573
gk837641
gk402625
WBVar01650248
WBVar01650249
WBVar02023441
WBVar02023442
WBVar02121261
gk963023
WBVar02072512
gk961677
WBVar02122023
gk232581
WBVar02115283
WBVar02004815
WBVar02004814
WBVar01997452
WBVar01459316
WBVar01459317

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00018556 4266375 4268313 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_4264617..4266374   1758 V: 4264617-4266374 Caenorhabditis elegans

29 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. Student's t-test, fold change > 2, p-value < 0.05. WBPaper00055386:daf-2(e1370)_upregulated
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
  Transcripts that showed significantly increased expression in fmi-1(rh308) young adults comparing to in N2 animals. fold change > 2, p-value < 0.05 WBPaper00066618:fmi-1(rh308)_upregulated
  Genes that showed significant differential expressed between control and 20 mg\/L Cadmium treatment. t-test, p < 0.05. WBPaper00036123:Cadmium_regulated
  Transcripts that showed differential expression in dauer N2 vs dauer mir-34(gk437) animals at 20C. N.A. WBPaper00050488:N2_vs_mir-34(gk437)_regulated_dauer_20C
  Genes up regulated by mir-243(n4759). RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243. WBPaper00036130:mir-243_up_regulated
EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at just prior to the third UVC dose (48h). Genes differentially expressed under EtBr treatment without UVC exposure vs after UVC exposure but without EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:EtBr-exposed_vs_UVC-exposed_48h
  Coexpression clique No. 1, Y40H4A.2-ZK1053.2, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:Y40H4A.2-ZK1053.2
  Genes that showed significantly increased expression in after 5 hours of 30ug/ml tunicamycin(TM) treatment comparing to control animals. N.A. WBPaper00045390:tunicamycin_upregulated
  Genes that showed more than 2 fold increased expression in pmk-1(km25) comparing to in N2 when fed with OP50. The significantly expressed genes were selected based on ANOVA analysis by Partek Genomics Suite software. Genes with a p-value of <0.05 and a 2-fold or greater fold change were considered differentially expressed. WBPaper00046083:pmk-1(km25)_OP50_downregulated
  Genes in the bottom 10% of expression level across the triplicate L3 samples. To generate the top10 and bottom10 gene sets, authors ranked all genes by mean expression array signal intensity across the three replicates, then took the top and bottom deciles (1,841 genes each) to represent genes with high and low expression. To generate the top10 and bottom10 gene sets, authors ranked all genes by mean expression array signal intensity across the three replicates, then took the top and bottom deciles (1,841 genes each) to represent genes with high and low expression. WBPaper00032528:L3_depleted
  Transcripts that showed significantly increased expression in nhr-8(hd117) comparing to in N2. Differentially expressed genes were identified using Sleuth (version 0.30.0). WBPaper00062446:nhr-8(hd117)_upregulated
  Genes predicted to be downregulated more than 2.0 fold in rde-3(ne298) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rde-3(ne298)_downregulated
  Genes predicted to be downregulated more than 2.0 fold in eri-1(mg366) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:eri-1(mg366)_downregulated
  Transcripts that showed significantly increased expression in mrps-5(RNAi) comparing to in control animals. Fold change > 4, p-value < 0.01 WBPaper00056330:mrps-5(RNAi)_upregulated
Bacteria Diet: L. plantarum with pdxH mutant vs. L. plantarum Transcripts that showed significantly increased expression in N2 animals fed with L. plantarum with pdxH mutant, comparing to in N2 animals fed with L. plantarum. GFold3, logFC < -1 or > 1. WBPaper00066703:L.plantarum-pdxH_upregulated
  Genes that showed decreased expression in bar-1(ga80) animal comparing to in N2. All statistical analyses were performed using the statistical programming language R (version 2.13.1 x 64). A linear model was used to determine the effect and significance of the genotype on the expression levels (probe intensity + genotype + error). Using permutations of the original data in the same linear model, authors determined thresholds adjusted for multiple testing (FDR 0.05: -log10(p) > 2; FDR 0.01: -log10(p) > 3). To correct for the developmental difference between bar-1(ga80) and N2 authors used the developmental gene expression data from Snoek et al. (2014) together with the gene expression data generated for this study (bar-1(ga80) vs. N2) in one linear model (probe intensity, sample age + genotype + error). The intensities were corrected for batch effect and for sample age authors used an age of 44 hours for the bar-1(ga80) samples (as estimated), and 48 hours for the N2 samples. WBPaper00045257:bar-1(ga80)_downregulated
  Genes that showed significantly increased expression in ubc-9(RNAi) animals comparing to control RNAi animals. N.A. WBPaper00045390:ubc-9(RNAi)_upregulated
UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at 3 h after the first UVC dose (3h). Genes differentially expressed under EtBr treatment and UVC exposure vs under UVC exposure but without EtBr treatment at the -45h timepoint (3 hours after the first UVC dose). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:UVC-EtBr-exposed_vs_UVC-exposed_3h
  Transcripts that showed significantly decreased expression in scc-1(ubs19) comparing to in control animals. DESeq2 v.1.34, fold change > 2, FDR < 0.05. WBPaper00067078:scc-1(ubs19)_downregulated
  Genes predicted to be downregulated more than 2.0 fold in rrf-2(ok210) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rrf-2(ok210)_downregulated
  Genes predicted to be downregulated more than 2.0 fold in rrf-3(pk1426) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rrf-3(pk1426)_downregulated
  Genes specifically expressed in somatic tissue when comparing RNAseq data of N2 to glp-4(bn2ts). Authors extracted all genes with more than 25 mapped reads and computed fold changes for all gene loci between wild type and mutants. The group of genes with 4-fold up-regulation in wild type was considered to be specifically expressed in the germline, while genes with 4-fold down-regulation in wild type where assumed to be specific to somatic cell lineages. WBPaper00044760:somatic_specific
  Transcripts that showed significantly decreased expression in kle-2(ubs14) comparing to in control animals. DESeq2 v.1.34, fold change > 2, FDR < 0.05. WBPaper00067078:kle-2(ubs14)_downregulated
  Transcripts that showed significantly decreased expression in dpy-26(ubs4) comparing to in control animals. DESeq2 v.1.34, fold change > 2, FDR < 0.05. WBPaper00067078:dpy-26(ubs4)_downregulated

4 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC14840 [srt-36::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGAACATCATCGTTTTTCCT] 3' and primer B 5' [CAAAATGTGGTTGATCGGG] 3'. Expr6104 Larval Expression: intestine; rectal gland cells; Nervous System; head neurons;  
    Expr14148 ASI, sometimes a couple other dim head neurons - dim and variable  
    Expr1151497 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1016547 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00018556 4266375 4268313 -1

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1939

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_4268314..4269454   1141 V: 4268314-4269454 Caenorhabditis elegans