WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00020347 Gene Name  ech-1.2
Sequence Name  ? T08B2.7 Brief Description  ech-1.2 encodes one of two C. elegans enoyl-CoA hydratases/long-chain 3-hydroxyacyl-CoA dehydrogenases [EC:4.2.1.17 1.1.1.211] orthologous to human HADHA (hydroxyacyl-coenzyme A dehydrogenase/3-ketoacyl-coenzyme A thiolase/enoyl-coenzyme a hydratase (trifunctional protein), alpha subunit OMIM:600890), which when mutated leads to disease.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable enoyl-CoA hydratase activity and long-chain-3-hydroxyacyl-CoA dehydrogenase activity. Predicted to be involved in fatty acid beta-oxidation. Predicted to be located in mitochondrion. Predicted to be part of mitochondrial fatty acid beta-oxidation multienzyme complex. Expressed in tail. Human ortholog(s) of this gene implicated in Alzheimer's disease; mitochondrial trifunctional protein deficiency; and steatotic liver disease. Is an ortholog of human HADHA (hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha).
Biotype  SO:0001217 Genetic Position  I :0.878928±
Length (nt)  ? 4201
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00020347

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T08B2.7b.2 T08B2.7b.2 2580   I: 6206955-6209946
Transcript:T08B2.7b.3 T08B2.7b.3 2525   I: 6206955-6209747
Transcript:T08B2.7a.1 T08B2.7a.1 2647   I: 6206955-6211155
Transcript:T08B2.7b.1 T08B2.7b.1 2586   I: 6206955-6209939
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T08B2.7b T08B2.7b 2268   I: 6207208-6207499
CDS:T08B2.7a T08B2.7a 2346   I: 6207208-6207499

17 RNAi Result

WormBase ID
WBRNAi00000549
WBRNAi00052844
WBRNAi00052845
WBRNAi00004170
WBRNAi00070993
WBRNAi00026235
WBRNAi00004171
WBRNAi00097980
WBRNAi00062051
WBRNAi00084357
WBRNAi00084383
WBRNAi00084405
WBRNAi00023306
WBRNAi00023582
WBRNAi00023816
WBRNAi00024104
WBRNAi00075801

44 Allele

Public Name
gk962858
gk962706
gk963902
gk964505
tm11181
WBVar02072815
gk558647
gk855229
gk655201
gk833754
gk796849
gk751788
gk328979
gk640156
gk851366
gk527451
gk813341
gk524985
gk534505
gk555027
gk539194
gk610718
gk340935
gk713525
gk606138
gk493003
gk504627
gk785854
gk534504
gk902996

1 Chromosome

WormBase ID Organism Length (nt)
I Caenorhabditis elegans 15072434  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00020347 6206955 6211155 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_6206928..6206954   27 I: 6206928-6206954 Caenorhabditis elegans

127 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  oocyte proteins identified by two or more unique peptides during proteomics study. In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. WBPaper00038289:oocyte_protein
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Genes that were downregulated in lin-15B(n744). For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. WBPaper00038168:lin-15B(n744)_downregulated
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_N2
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_aging
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_aging
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
  Transcripts expressed in vulva. FPKM >= 1. WBPaper00064122:vulva_transcriptome
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:S.aureus-4h_upregulated_N2
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines. RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1. WBPaper00035269:cde-1_regulated
  Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_oocyte_depleted
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC15507 [T08B2.7b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGCCGTAATGCAACGATT] 3' and primer B 5' [GACGCGACAAGATTTCCTATAAA] 3'. Expr6639 Adult Expression: intestine; body wall muscle; hypodermis; Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in tail ; Larval Expression: intestine; body wall muscle; hypodermis; Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in tail ;  
    Expr2011165 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1038864 Tiling arrays expression graphs  
    Expr1156447 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1023592 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2029401 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

18 GO Annotation

Annotation Extension Qualifier
  part_of
  part_of
  located_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables

6 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00020347 6206955 6211155 -1

18 Ontology Annotations

Annotation Extension Qualifier
  part_of
  part_of
  located_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
4201

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00003519

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_6211156..6211269   114 I: 6211156-6211269 Caenorhabditis elegans