WormMine: Gene WBGene00020647

• WormBase Gene ID: WBGene00020647
• Gene Name: pqbp-1.1
• Sequence Name: T21D12.3
• Brief Description: pqbp-1.1 encodes the C. elegans ortholog of human PQBP1; loss of pqbp-1.1 results in decreased incorporation of fatty acid into triglyceride in intestinal cells suggesting that pqbp-1.1 plays a role in lipid metabolism; a PQBP-1.1::Venus fusion protein is expressed from the 24-cell (proliferative) stage of embryogenesis through adulthood in several tissues, including neurons, with expression in larvae and adults highest in the intestine; the PQBP-1.1 fusion protein localizes to speckle-like intranuclear bodies.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ribonucleoprotein complex binding activity. Involved in triglyceride metabolic process. Located in nuclear body. Expressed in gonad. Used to study Renpenning syndrome. Human ortholog(s) of this gene implicated in Renpenning syndrome. Is an ortholog of human PQBP1 (polyglutamine binding protein 1).
• Biotype: SO:0001217
• Genetic Position: IV :-26.7603 ±0.005805
• Length (nt): 1695

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00020647

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T21D12.3.1	T21D12.3.1	1057	IV: 259989-261683

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T21D12.3	T21D12.3	843	IV: 260200-260347

9 RNAi Result

• WBRNAi00052696
• WBRNAi00053730
• WBRNAi00018975
• WBRNAi00076694
• WBRNAi00114646
• WBRNAi00023323
• WBRNAi00023610
• WBRNAi00023836
• WBRNAi00024124

21 Allele

• gk963025
• gk963690
• gk191656
• gk191654
• gk191655
• gk191653
• gk191657
• tm2200
• tm2492
• tm3004
• ttTi479
• ok2670
• WBVar01450051
• gk701243
• gk401359
• gk584520
• gk877597
• gk495403
• gk453737
• gk342228
• gk582351

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00020647
• Start: 259989
• End: 261683
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_259205..259988
• Length (nt): 784
• Chromosome Location: IV: 259205-259988
• Organism: Caenorhabditis elegans

88 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines.	RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1.	WBPaper00035269:cde-1_regulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly increased expression in animals exposed to Leptomycin B for 20 hours at 25C.	p < 0.01, logFC > 1 or p < 0.01, logFC < -1.	WBPaper00066610:Leptomycin-B_upregulated_25C_20h
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Starvation 48 hours at L1 arrest	Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest)	Fold change > 2.	WBPaper00064005:starvation_upregulated_N2_mRNA
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts unqiuely expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_enriched
	Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated
	Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh, triggered by the dafachronic acid (DA) growth hormone6). Cluster 2 genes' expression gradually increased into dauer.	Benjamini Hochberg corrected q-value < 0.01.	WBPaper00053388:dauer_regulated_Cluster2
	Genes that showed significantly altered expression between N2 and npr-1(ur89) strains exposed to either the nematocidal B. thuringiensis B-18247, the pathogenic P. aeruginosa PA14, or the control E. coli OP50 for 12 or 24 hours.	Estimation of transcript abundance and significantly differentially expressed genes were identified by Cuffdiff using the quartile normalization method. Transcripts with a significant change between different conditions (adjusted p-value < 0.01 by the false discovery rate, FDR) were treated as signature for each comparison.	WBPaper00049498:npr-1(ur89)_regulated_3
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated
	Transcripts that showed significantly increased expression in rgef-1p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:rgef-1p-jmjd-1.2(+)_upregulated
	Transcripts that showed significantly increased expression in sur-5p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:sur-5p-jmjd-1.2(+)_upregulated

8 Expression Patterns

• Primary Identifier: Expr6730
• Remark: Also expressed in (comments from author) : Mosaic population.Neural head and tail is possibly amphid/phasmid, but masked by pharynx and hypodermis Strain: BC11319
• Reporter Gene: [T21D12.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCACTCGTGACGCATTTG] 3' and primer B 5' [CTGGTGGAAGAGGGATTTTCT] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; uterine-seam cell; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; neurons along body; tail neurons; unidentified cells in body ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; developing vulva; developing uterus; developing spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; neurons along body; tail neurons; unidentified cells in body

• Primary Identifier: Expr8551
• Remark: Picture: Figure 2, 3, 4.
• Pattern: After becoming adult worm, pqbp-1.1-Venus expression reduced rapidly in pharynx, while the expression continued in intestinal cells. During the development, somatic gonad cells expressed pqbp-1.1-Venus only from L3 to L4 stage, and adult gonads or fertilized eggs did not express pqbp-1.1-Venus. Pqbp-1.1 expression was also observed in head ganglion cells at L1 stage. Some neurons in the tail show weak expression of pqbp-1.1-Venus in adult worms. However, after L1 stage, expression in neurons was relatively weak in comparison to that in intestinal cells or somatic gonad, and further analysis is needed to clarify the detail. pqbp-1.1 was expressed from 24-cells stage to Larva stage 4 (L4). From 24 cells- to gastrulation-stage, pqbp-1.1-Venus was expressed ubiquitously. At L1 stage, neural cells in the head ganglion express the fusion protein. From late L1 stage, intestinal cells expressed pqbp-1.1-Venus strongly and the high expression continued to L4 stage. The peak of expression was observed at L3 stage. Pharyngeal cells show an almost similar pattern of expression during development, while the peak seems to be at L4 stage.
• Subcellular Localization: In pharynx, higher magnification of the signals revealed that the fusion protein formed speckle-like intranuclear dots (or nuclear bodies) just like mammalian PQBP1.

• Primary Identifier: Chronogram205
• Remark: Original chronogram file: chronogram.1233.xml
• Reporter Gene: [T21D12.3:gfp] transcriptional fusion.

• Primary Identifier: Expr1038993
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1024539
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2015027
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1157282
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2033262
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

6 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00020647
• Start: 259989
• End: 261683
• Strand: -1

6 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1695

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00032701
• WBStrain00001715

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_261684..261885
• Length (nt): 202
• Chromosome Location: IV: 261684-261885
• Organism: Caenorhabditis elegans