Genomics
9 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:M03A1.6a.1 | M03A1.6a.1 |
2967
![]() |
II: 4590939-4596729 |
Transcript:M03A1.6b.4 | M03A1.6b.4 |
2819
![]() |
II: 4590941-4597999 |
Transcript:M03A1.6b.3 | M03A1.6b.3 |
3016
![]() |
II: 4590941-4599008 |
Transcript:M03A1.6b.2 | M03A1.6b.2 |
2875
![]() |
II: 4590941-4600022 |
Transcript:M03A1.6b.1 | M03A1.6b.1 |
3048
![]() |
II: 4590950-4601354 |
Transcript:M03A1.6f.1 | M03A1.6f.1 |
2007
![]() |
II: 4591461-4595492 |
Transcript:M03A1.6c.1 | M03A1.6c.1 |
2490
![]() |
II: 4591461-4599002 |
Transcript:M03A1.6d.1 | M03A1.6d.1 |
2334
![]() |
II: 4591461-4600001 |
Transcript:M03A1.6e.1 | M03A1.6e.1 |
2539
![]() |
II: 4591461-4601356 |
Other
6 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:M03A1.6b | M03A1.6b |
2262
![]() |
II: 4591461-4591604 |
CDS:M03A1.6a | M03A1.6a |
2298
![]() |
II: 4591461-4591604 |
CDS:M03A1.6c | M03A1.6c |
2340
![]() |
II: 4591461-4591604 |
CDS:M03A1.6d | M03A1.6d |
2334
![]() |
II: 4591461-4591604 |
CDS:M03A1.6e | M03A1.6e |
2523
![]() |
II: 4591461-4591604 |
CDS:M03A1.6f | M03A1.6f |
2007
![]() |
II: 4591461-4591604 |
146 Allele
Public Name |
---|
gk963801 |
gk963053 |
h15402 |
WBVar01603729 |
WBVar01603728 |
WBVar01603730 |
WBVar01603731 |
tm471 |
WBVar01437545 |
WBVar01437546 |
gk963512 |
WBVar01372045 |
WBVar01372022 |
WBVar01372033 |
WBVar01719579 |
WBVar02029202 |
WBVar02070664 |
WBVar02076346 |
WBVar01982409 |
WBVar01982407 |
WBVar01982408 |
gk141129 |
gk141130 |
gk141131 |
gk141132 |
gk141127 |
gk141128 |
gk141126 |
gk141137 |
gk141138 |
1 Chromosome Location
Feature . Primary Identifier |
Start | End | Strand |
---|---|---|---|
WBGene00019747 | 4590939 | 4601356 | -1 |
4 Data Sets
Name | URL |
---|---|
WormBaseAcedbConverter | |
GO Annotation data set | |
C. elegans genomic annotations (GFF3 Gene) | |
Panther orthologue and paralogue predictions |
118 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141) | |
Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). | Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. | WBPaper00040858:eQTL_regulated_reproductive | |
Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage. | DESeq2, fold change > 2 | WBPaper00058725:sftb-1(cer6)_downregulated | |
Maternal class (M): genes that are called present in at least one of the three PC6 replicates. | A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. | [cgc5767]:expression_class_M | |
Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment. | The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. | WBPaper00065373:sek-1(km4)_downregulated_cisplatin | |
Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:nuo-6(qm200)_upregulated | |
Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Psora-Allantoin_downregulated | |
Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rapamycin-Metformin_downregulated | |
Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin-Allantoin_downregulated | |
Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00066594:ilc-17.1(syb5296)_upregulated | |
Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin. | N.A. | WBPaper00055862:antimycin_damt-1(gk961032)_regulated | |
Proteins identified in extracellular vesicle. | N.A. | WBPaper00062669:extracellular-vesicle_protein | |
Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. | N.A. | WBPaper00026929:sir-2.1_overexpression_regulated | |
Transcripts of coding genes that showed significantly increased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_enriched_coding-RNA | |
Bacteria infection: Serratia marcescens | Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50. | For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. | WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray |
Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2 at early embryo stage. | DESeq2, FDR < 0.05 | WBPaper00058691:sin-3(tm1276)_upregulated | |
Genes expressed in N2. | Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. | WBPaper00025141:N2_Expressed_Genes | |
Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141) | |
Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_upregulated_glp-1(e2141) | |
WT-Pico Pan-neural Depleted Genes, with genes found multiple times in a single dataset removed (without dups). | To identify differentially expressed transcripts, normalized intensity values from the pan-neural data sets were compared to a reference (from all larval cells) using Significance Analysis of Microarray software (SAM). A two class unpaired analysis of the data was performed to identify neuron-enriched genes. Pan-neural enriched transcripts in the IVT and WT-Pico-derived data set were defined as 1.5X elevated vs the reference at a False Discovery Rate (FDR) = 3%. | WBPaper00031532:Larva_Pan_Neuronal_Depleted | |
Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated |
10 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Strain: BC14511 | [M03A1.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTGAGTTCTTTGGCAGTTTTC] 3' and primer B 5' [CGTTTGAGCCATCGTGTATTT] 3'. | Expr6411 | Adult Expression: arcade cells; intestine; rectal gland cells; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; pharyngeal neurons; Larval Expression: arcade cells; intestine; rectal gland cells; body wall muscle; hypodermis; excretory cell; Nervous System; pharyngeal neurons; | |
Picture: Figure S7, Movie 1. | Expr8105 | Expression patterns of ipla-1 in the adult stage. ipla-1 is expressed in several unidentified cells in pharynx (probably gland cells of pharynx), pharyngeal-intestinal valve, spermatheca, hypodermal syncytium, seam cells, rectal grand cells and intestinal-rectal valve. Expression patterns of ipla-1 in the larval stages. ipla-1 is expressed in intestine, three rectal gland cells, hypodermal syncytium and seam cells in the L1, L2 and L3 larva. In the L1 stage, ipla-1 expression is also observed in several unidentified cells in the tail. | While IPLA-1 localizes to cytosol in intestine, spermatheca and gland cells, IPLA-1 localizes to the nuclei of hypodermal syncytium and seam cells. | |
IPLA-1::mCherry and ACL-10::GFP rescued the phenotypes of ipla-1 mutants and acl-8 acl-9 acl-10 mutants, respectively, indicating that these fusion proteins are functional. Picture: Fig 7D, 7E. | Expr9098 | IPLA-1::mCherry and ACL-10::GFP were distributed in an ER-like reticular pattern throughout the cytoplasm and were partially colocalized. Both IPLA-1 and ACL-10 partially colocalized with an ER marker, ACS-20::EGFP. Furthermore, an immunoblot analysis revealed that both IPLA-1 and ACL-10 were present in the membrane fraction. IPLA-1 was also present in the soluble fraction. | ||
Expr1038538 | Tiling arrays expression graphs | |||
Original chronogram file: chronogram.2027.xml | [M03A1.6:gfp] transcriptional fusion. | Chronogram973 | ||
Expr2012806 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Expr1154539 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
Expr2031045 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Original chronogram file: chronogram.843.xml | [M03A1.6:gfp] transcriptional fusion. | Chronogram1923 | ||
Expr1027158 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
23 GO Annotation
Annotation Extension | Qualifier |
---|---|
part_of | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
located_in | |
located_in | |
located_in | |
located_in | |
enables | |
enables | |
enables | |
enables | |
enables | |
enables | |
involved_in | |
involved_in | |
enables | |
enables | |
enables | |
enables | |
enables | |
enables |
5 Homologues
Type |
---|
least diverged orthologue |
least diverged orthologue |
least diverged orthologue |
orthologue |
least diverged orthologue |