WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: arcade cells; intestine; rectal gland cells; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; pharyngeal neurons; Larval Expression: arcade cells; intestine; rectal gland cells; body wall muscle; hypodermis; excretory cell; Nervous System; pharyngeal neurons; Primary Identifier  Expr6411
Remark  Strain: BC14511 Reporter Gene  [M03A1.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTGAGTTCTTTGGCAGTTTTC] 3' and primer B 5' [CGTTTGAGCCATCGTGTATTT] 3'.

10 Anatomy Terms

Definition Name Synonym Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages. intestine gut WBbt:0005772
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
Epidermal layer. hypodermis epidermis WBbt:0005733
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812
neuron of the pharyngeal nervous system. pharyngeal neuron   WBbt:0005439
Interfacial (hypodermal) cells which connect the hypodermal epithelium of the lips to the pharyngeal epithelium, firmly binding the inner tissue (the pharynx) to the outer bodywall (the hypodermis). arcade cell   WBbt:0005793
  rectal gland cell   WBbt:0005799
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00019747 ipla-1 M03A1.6 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023