WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00019599 Gene Name  acds-10
Sequence Name  ? K09H11.1 Brief Description  K09H11.1 encodes an acyl CoA dehydrogenase; by homology, the product of K09H11.1 is predicted to function in fatty acid beta-oxidation; K09H11.1::yfp promoter fusions are expressed in the descendants of the tertiary vulval precursor cells P3.p, P4.p, and P8.p; large-scale expression studies reveal additional expression in the nervous system, intestine, and hypodermis.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable acyl-CoA dehydrogenase activity. Predicted to be involved in fatty acid beta-oxidation using acyl-CoA dehydrogenase. Predicted to be located in cytoplasm. Expressed in P3.p hermaphrodite; P4.p hermaphrodite; and P8.p hermaphrodite. Is an ortholog of human ACAD10 (acyl-CoA dehydrogenase family member 10).
Biotype  SO:0001217 Genetic Position  V :-1.01975±
Length (nt)  ? 4215
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00019599

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:K09H11.1.1 K09H11.1.1 3039   V: 5747819-5752033
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:K09H11.1 K09H11.1 2958   V: 5747820-5747889

3 RNAi Result

WormBase ID
WBRNAi00034221
WBRNAi00050457
WBRNAi00016939

81 Allele

Public Name
gk963301
gk963591
gk963553
gk964259
gk964351
gk963850
WBVar01862393
WBVar01862395
WBVar01862394
WBVar01588317
WBVar00245587
gk962695
WBVar01973615
WBVar01973614
WBVar01973616
WBVar02023712
WBVar02023711
WBVar01651676
WBVar01651678
WBVar01651677
WBVar01651679
cxTi9792
WBVar00209724
WBVar00209723
WBVar00209726
WBVar00209725
WBVar00209722
WBVar00209721
ttTi2945
gk675930

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00019599 5747819 5752033 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_5752034..5752351   318 V: 5752034-5752351 Caenorhabditis elegans

166 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults. Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05. WBPaper00061530:nhr-49(e2144)_downregulated
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C. DESeq2, fold change > 2, p-value < 0.05. WBPaper00061753:csr-1(tor159)_upregulated_25C
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq. DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison. WBPaper00045934:wrn-1(gk99)_upregulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day11_vs_Day1_downregulated
  Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. edgeR, fold change > 2, FDR < 0.05 WBPaper00060909:atfs-1(cmh15)_downregulated
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
mitochondrial sulfide delivery molecule (mtH2S) AP39 Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11
Bacteria infection: Bacillus thuringiensis Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. N.A. WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly decreased expression in skn-1gf(lax188) comparing to in N2 animals at L4 stage fed with OP50 and exposed to PA14 for 4 hours. DESeq2, FDR < 0.05, fold change > 2. WBPaper00067255:skn-1(lax188)_downregulated_PA
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Transcripts that showed significantly decreased expression in vit-2(ac3); zcIs4, comparing to parenting strain SJ4005 [zcIs4]. Differential gene expression analysis was then performed on normalized samples. Genes exhibiting at least twofold change and a false-discovery rate (FDR) of 1% or less were considered differentially expressed. WBPaper00051305:vit-2(ac3)_downregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:S.aureus-4h_upregulated_N2
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
  Transcripts that showed significantly decreased expression in N2 day 3 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day3_vs_Day1_downregulated_Illumina
  Transcripts that showed significantly decreased expression in N2 day 4 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day4_vs_Day1_downregulated_Illumina
  Transcripts that showed significantly decreased expression in N2 day 4 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS). DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day4_vs_Day1_downregulated_Nanopore
  Transcripts that showed significantly decreased expression in N2 day 5 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day5_vs_Day1_downregulated_Illumina
  Transcripts that showed significantly decreased expression in N2 day 5 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS). DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day5_vs_Day1_downregulated_Nanopore
  Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day7_vs_Day1_downregulated_Illumina
  Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS). DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day7_vs_Day1_downregulated_Nanopore

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2009141 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Strain: BC13577 [K09H11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAAATGGGGCTTGTTTAGTTA] 3' and primer B 5' [CGCTTTGATGGTGATTCTGA] 3'. Expr6377 Adult Expression: intestine; Larval Expression: intestine; hypodermis; Nervous System; head neurons; tail neurons;  
Picture: N.A.   Marker18 Expressed in tertiary fate VPC.  
    Expr1038462 Tiling arrays expression graphs  
Original chronogram file: chronogram.1304.xml [K09H11.1:gfp] transcriptional fusion. Chronogram281    
    Expr2027378 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1154164 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1018739 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

10 GO Annotation

Annotation Extension Qualifier
  involved_in
  located_in
  located_in
  located_in
  located_in
  located_in
  enables
  enables
  enables
  involved_in

3 Homologues

Type
least diverged orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00019599 5747819 5752033 1

10 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  located_in
  located_in
  located_in
  located_in
  located_in
  enables
  enables
  enables
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
4215

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00002652

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_5736537..5747818   11282 V: 5736537-5747818 Caenorhabditis elegans