WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00020286 Gene Name  gtsf-1
Sequence Name  ? T06A10.3 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable zinc ion binding activity. Located in cytoplasm. Is an ortholog of human GTSF1 (gametocyte specific factor 1). Biotype  SO:0001217
Genetic Position  IV :15.3793± Length (nt)  ? 665
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00020286

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T06A10.3a.1 T06A10.3a.1 554   IV: 16865840-16866504
Transcript:T06A10.3b.1 T06A10.3b.1 464   IV: 16865979-16866504
Transcript:T06A10.3c.1 T06A10.3c.1 327   IV: 16866134-16866460
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T06A10.3a T06A10.3a 510   IV: 16865840-16865923
CDS:T06A10.3b T06A10.3b 420   IV: 16865979-16866058
CDS:T06A10.3c T06A10.3c 327   IV: 16866134-16866460

2 RNAi Result

WormBase ID
WBRNAi00052608
WBRNAi00052609

45 Allele

Public Name
gk964078
gk964500
gk962765
gk963590
gk963795
gk962529
gk963948
gk963888
WBVar02122004
WBVar01821980
WBVar01660294
WBVar01660293
WBVar01669370
WBVar01669359
WBVar01669358
WBVar01669367
WBVar01669366
WBVar01669365
WBVar01669364
WBVar01669369
WBVar01669368
WBVar01669363
WBVar01669362
WBVar01669361
WBVar01669360
xf43
xf44
xf45
gk894182
gk521138

1 Chromosome

WormBase ID Organism Length (nt)
IV Caenorhabditis elegans 17493829  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00020286 16865840 16866504 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_16866505..16867522   1018 IV: 16866505-16867522 Caenorhabditis elegans

75 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
Bacteria diet: Escherichia coli HB101. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:S.aquatilis_downregulated
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
25C vs. 20C Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:25C_vs_20C_upregulated
  Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:Day10_vs_Day1_upregulated
  Genes with increased RNA expression after 24 hours rotenone treatment EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed. WBPaper00044426:rotenone_24h_upregulated
Pheromone Pheromone-induced transcripts that showed significantly decreased expression in post dauer animals comparing to wild type control. edgeR WBPaper00053713:Pheromone-induced_postdauer_vs_control_downregulated
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
Starvation 48 hours at L1 arrest Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest) Fold change > 2. WBPaper00064005:starvation_upregulated_N2_mRNA
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_downregulated
  Transcripts that showed significantly increased expression in cfp-1(tm6369) comparing to in N2 at early embryo stage. DESeq2, FDR < 0.05 WBPaper00058691:cfp-1(tm6369)_upregulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed under EtBr treatment without UVC exposure vs after UVC exposure but without EtBr treatment at the -3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:EtBr-exposed_vs_UVC-exposed_51h
  Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh, triggered by the dafachronic acid (DA) growth hormone6). Cluster 2 genes' expression gradually increased into dauer. Benjamini Hochberg corrected q-value < 0.01. WBPaper00053388:dauer_regulated_Cluster2
  Transcripts that showed significantly decreased expression in let-767(RNAi) L4 animals comparing to animals fed with empty vector. log2 fold change > 1.5 or < -1.5, p-value < 0.05 WBPaper00066679:let-767(RNAi)_downregulated
  Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector. Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples. WBPaper00051039:germline_enriched
Fungi infection: Drechmeria coniospora. 24 hours of infection. Genes that showed increased expression after 24 hours of infection by fungi Drechmeria coniospora. Differentially regulated genes based on fold change, corresponding to the uppermost 18.75th percentile of datasets formed using genes with normalized, expression ratios (infected/control) >1.01 or <0.99 in at least ten out of fourteen arrays are shown. WBPaper00032031:DConiospora_upregulated_OligoArray_24h
Bacteria infection: Xenorhabdus nematophila Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila. Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets. WBPaper00041606:CE_X.nematophila_regulated
control(maintained under normal lab light (mostly dark, in incubators).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed in control vs under EtBr treatment without UVC exposure, at the 3h timepoint. Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_EtBr-exposed_51h
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h). Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-EtBr-exposed_48h

7 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr13773   C. elegans GTSF-1 is enriched in the germline cytoplasm, but mostly outside perinuclear granules.
Operon: CEOP4668 The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http://www.addgene.org/pgvec1?f=3Dc&cmd=3Dshowcol&colid=3D 1) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70=961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1 ::ORF::GFP expression clones. Expr9575   Sub-cellular localization within the body wall muscle: Cytoplasm +/- Other
    Expr2024132 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1038835 Tiling arrays expression graphs  
    Expr1156216 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1013260 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2005916 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

3 GO Annotation

Annotation Extension Qualifier
  enables
  enables
part_of(WBbt:0006804) located_in

11 Homologues

Type
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
least diverged orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00020286 16865840 16866504 1

3 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
part_of(WBbt:0006804) located_in

0 Regulates Expr Cluster

1 Sequence

Length
665

1 Sequence Ontology Term

Identifier Name Description
gene  

3 Strains

WormBase ID
WBStrain00033319
WBStrain00033318
WBStrain00033320

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_16865487..16865839   353 IV: 16865487-16865839 Caenorhabditis elegans