WormMine: Gene WBGene00022599

• WormBase Gene ID: WBGene00022599
• Gene Name: daf-41
• Sequence Name: ZC395.10
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable Hsp90 protein binding activity and protein-folding chaperone binding activity. Predicted to be involved in chaperone-mediated protein complex assembly and protein folding. Located in myofibril. Expressed in several structures, including amphid neurons; anal depressor muscle; phasmid neurons; touch receptor neurons; and vulva. Human ortholog(s) of this gene implicated in atherosclerosis; breast cancer; and oligodendroglioma. Is an ortholog of human PTGES3 (prostaglandin E synthase 3).
• Biotype: SO:0001217
• Genetic Position: III :-1.84928±
• Length (nt): 961

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00022599

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZC395.10.1	ZC395.10.1	721	III: 5273805-5274765

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZC395.10	ZC395.10	528	III: 5273989-5274047

12 RNAi Result

• WBRNAi00066924
• WBRNAi00058865
• WBRNAi00106361
• WBRNAi00106285
• WBRNAi00000372
• WBRNAi00021664
• WBRNAi00005226
• WBRNAi00038031
• WBRNAi00062001
• WBRNAi00111776
• WBRNAi00106286
• WBRNAi00106405

15 Allele

• WBVar01263532
• WBVar01263531
• ok3052
• ok2968
• ok3015
• gk799191
• gk903565
• gk851075
• gk730115
• gk853552
• gk572734
• WBVar01644637
• gk174386
• gk174388
• gk174387

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00022599
• Start: 5273805
• End: 5274765
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_5273472..5273804
• Length (nt): 333
• Chromosome Location: III: 5273472-5273804
• Organism: Caenorhabditis elegans

163 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Pheromone	Pheromone-induced transcripts that showed significantly decreased expression in post dauer animals comparing to wild type control.	edgeR	WBPaper00053713:Pheromone-induced_postdauer_vs_control_downregulated
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated

12 Expression Patterns

• Primary Identifier: Expr2026850
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram171
• Remark: Original chronogram file: chronogram.1200.xml
• Reporter Gene: [ZC395.10:gfp] transcriptional fusion.

• Primary Identifier: Expr12330
• Remark: A promoter fusion to gfp, daf- 41p::gfp, revealed expression most prominently in anterior and posterior neurons including amphids (e.g. ASE, AWC, ASI, ADL) and phasmid sensory neurons, as well as peripheral neurons and ventral cord motorneurons. We also observed strong expression in body wall muscle and pharynx, as well as occasional expression in vulva, seam and intestine.

• Primary Identifier: Expr1017759
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1101
• Remark: Original chronogram file: chronogram.22.xml
• Reporter Gene: [ZC395.10:gfp] transcriptional fusion.

• Primary Identifier: Expr2008614
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr9366
• Remark: Operon: CEOP3276
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons. Larval Expression: pharynx; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Myofilaments +/- Dense bodies

• Primary Identifier: Expr7164
• Remark: Strain: BC12469
• Reporter Gene: [ZC395.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGGAAATGAAAATACAATCACAG] 3' and primer B 5' [TTGGTTGCTTAGCGATGG] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons

• Primary Identifier: Expr15094
• Pattern: HSP-90 and the cochaperones DAF-41, STI-1, and PPH-5 are expressed in most C. elegans cells (Gillan et al., 2009; Richie et al., 2011; Song et al., 2009), and we confirmed their expression in the TRNs.

• Primary Identifier: Expr1162306
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr7165
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC10796
• Reporter Gene: [ZC395.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGGAAATGAAAATACAATCACAG] 3' and primer B 5' [TTGGTTGCTTAGCGATGG] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr1039982
• Pattern: Tiling arrays expression graphs

8 GO Annotation

11 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00022599
• Start: 5273805
• End: 5274765
• Strand: -1

8 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 961

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00032911
• WBStrain00032936
• WBStrain00037205
• WBStrain00001518

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_5274766..5275250
• Length (nt): 485
• Chromosome Location: III: 5274766-5275250
• Organism: Caenorhabditis elegans