WormMine: Gene WBGene00028298

• WormBase Gene ID: WBGene00028298
• Gene Name: Cbr-emc-6
• Sequence Name: CBG05942
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in endoplasmic reticulum and membrane. Predicted to be part of EMC complex. Expressed widely. Is an ortholog of C. elegans emc-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05942.1	CBG05942.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05942	CBG05942		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr10629
• Pattern: In mosaic animals, GFP was detected in almost all tissues, including neurons and muscle cells. Transgenes driving GFP expression under the control of the 263-bp promoter sequence used for emc-6 rescue experiments induced lethality and did not transmit GFP expression after one generation. To bypass this technical issue, the authors characterized the expression pattern of the Caenorhabditis briggsae ortholog of emc-6 (Cb-emc-6) in C. elegans. Interestingly, transgenic expression of Cb-emc- 6 was nontoxic in C. elegans. GFP expression was observed in every tissue from the threefold stage to adulthood. Altogether, these results suggest that emc-6 is ubiquitously expressed.
• Subcellular Localization: EMC-6 primarily localize to the ER.

• Primary Identifier: Expr1069917
• Remark: CBG05942, GGAACGTGAAAGCTCAAGGAAACTGGCTCAGCTACTTTCCAGAGAGAAACTCCTTCACCT, WBGene00028298
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region