WormMine: Gene WBGene00033805

• WormBase Gene ID: WBGene00033805
• Gene Name: Cbr-cki-2
• Sequence Name: CBG12949
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable cyclin-dependent protein serine/threonine kinase inhibitor activity. Predicted to be involved in regulation of cell cycle. Predicted to be located in nucleus. Is an ortholog of C. elegans cki-2. In C. elegans, cki-2 is involved in gonad development; regulation of cell cycle process; and regulation of cell division.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12949.1	CBG12949.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12949	CBG12949		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062956
• Remark: Cbr-cki-2.1, CCATGGACTCCACCGCTGCACCACAGAAAGAGAAACGTGGATCCAAACACGGAAACAACA, WBGene00033803
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region