WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00137812 Gene Name  Cjp-epi-1
Sequence Name  ? CJA18609 Organism  Caenorhabditis japonica
Automated Description  Predicted to be involved in cell adhesion. Is an ortholog of C. elegans epi-1. In C. elegans, epi-1 is involved in several processes, including basement membrane organization; generation of neurons; and response to stress. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA18609.1 CJA18609.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA18609 CJA18609   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA18609, CTGAATCTTCCAACTACAATGACGGAAAATGGCACACTGTTTCGATCGTCAGAGAAGAGA, WBGene00137812   Expr1087207 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA27839, CAGTGGAGTATGTGAATGGATCTATCAAAACTACAGTAGACAGTGGAAGCGGAGGAGAGG, WBGene00183412   Expr1073485 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA24873, GCGCAGAAAGAAGGCGGTGGATACGGAACGATTTGATGTTTTCGGTGATGTGCATCGCAA, WBGene00180445   Expr1076120 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region