WormMine: Gene WBGene00000962

• WormBase Gene ID: WBGene00000962
• Gene Name: dhc-1
• Sequence Name: T21E12.4
• Brief Description: dhc-1 encodes a cytoplasmic dynein heavy chain homolog required in one-cell embryos for pronuclear migration, centrosome separation, centrosome proximity to the male pronucleus, and mitotic spindle orientation, suggesting that DHC-1 helps position the microtubule organizing center; DHC-1 genetically interacts with SPD-5, a coiled-coil centrosomal protein.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable dynein intermediate chain binding activity; dynein light intermediate chain binding activity; and minus-end-directed microtubule motor activity. Involved in several processes, including neuron remodeling; organelle localization; and regulation of cellular localization. Located in several cellular components, including kinetochore; nuclear envelope; and spindle pole. Expressed in germ cell; head; somatic cell; and tail. Used to study epilepsy and lissencephaly. Human ortholog(s) of this gene implicated in Alzheimer's disease; Charcot-Marie-Tooth disease axonal type 2O; autosomal dominant intellectual developmental disorder 13; and spinal muscular atrophy with lower extremity predominant 1. Is an ortholog of human DYNC1H1 (dynein cytoplasmic 1 heavy chain 1).
• Biotype: SO:0001217
• Genetic Position: I :-1.31043 ±0.007943
• Length (nt): 15123

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000962

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T21E12.4a.1	T21E12.4a.1	13864	I: 4386785-4401907
Transcript:T21E12.4b.1	T21E12.4b.1	10911	I: 4390095-4401755

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T21E12.4a	T21E12.4a	13707	I: 4386790-4387461
CDS:T21E12.4b	T21E12.4b	10911	I: 4390095-4391499

43 RNAi Result

• WBRNAi00095735
• WBRNAi00085605
• WBRNAi00107830
• WBRNAi00064280
• WBRNAi00062967
• WBRNAi00082903
• WBRNAi00111071
• WBRNAi00064968
• WBRNAi00090795
• WBRNAi00091215
• WBRNAi00091214
• WBRNAi00060973
• WBRNAi00080549
• WBRNAi00078499
• WBRNAi00078498
• WBRNAi00062966
• WBRNAi00062965
• WBRNAi00085215
• WBRNAi00000102
• WBRNAi00000209
• WBRNAi00053742
• WBRNAi00022752
• WBRNAi00022770
• WBRNAi00026345
• WBRNAi00077276
• WBRNAi00077290
• WBRNAi00116629
• WBRNAi00114569
• WBRNAi00079271
• WBRNAi00096853

201 Allele

• gk962706
• gk963902
• gk964159
• gk964070
• WBVar01431375
• WBVar01431374
• WBVar01431373
• WBVar01431372
• WBVar01602953
• gk568153
• gk677826
• gk442865
• gk918913
• gk912641
• gk848653
• gk856676
• gk630405
• gk785073
• gk830669
• gk639585
• gk418449
• gk509357
• gk660692
• gk856678
• gk856677
• gk830668
• gk581030
• gk497430
• gk872301
• gk868352

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000962
• Start: 4386785
• End: 4401907
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_4401908..4401955
• Length (nt): 48
• Chromosome Location: I: 4401908-4401955
• Organism: Caenorhabditis elegans

140 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:germline-precursors_blastula-embryo_expressed
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after N2 animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_N2
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in pry-1(mu38) animals comparing to in N2 at L1 larva stage.	DESeq, FDR < 0.05	WBPaper00055626:pry-1(mu38)_upregulated
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated

19 Expression Patterns

• Primary Identifier: Expr6732
• Remark: Strain: BC13242
• Reporter Gene: [dhc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAGCAAACGCATCATACAG] 3' and primer B 5' [ATTCCCACTATCGATTACCTGAAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; anal depressor muscle; body wall muscle; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr1030597
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr8622
• Remark: Picture: Figure 3C.
• Subcellular Localization: Endogenous DHC-1 was localized uniformly on metaphase meiotic spindles and concentrated at poles of rotated meiotic spindles.

• Primary Identifier: Expr8621
• Remark: Picture: Figure 3A, 3B.
• Subcellular Localization: During eight of eight time-lapse sequences of wild-type meiosis, GFP:DHC-1 was uniformly localized throughout the meiotic spindle before APC activation. Within 45 to 30 s before spindle rotation, GFP:DHC-1 began to accumulate at both spindle poles and continued to accumulate at the meiotic spindle poles through rotation. After rotation, GFP:DHC-1 stayed on the meiotic spindle poles but did not accumulate further. In some cases, DHC-1 accumulated slightly more on one pole versus the other (Figure 3B), but there was no consistent trend of which pole was brighter between the proximal pole (near the cortex) and distal pole.

• Primary Identifier: Expr13421
• Subcellular Localization: DHC-1 was observed, as previously reported, in perinuclear patches in the transition zone (Sato et al., 2009) and at the nuclear envelope in pachytene.

• Primary Identifier: Expr2010871
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr13458
• Subcellular Localization: Epifluorescence microscopy revealed that mCherry::DHC-1 and eGFP::DHC-1 are expressed in all somatic tissues and in the germline. After imaging early embryos by spinning-disk confocal fluorescence microscopy (SDCM), DHC-1 was detected in the cytoplasm during all stages of the cell cycle and localized specifically to the nuclear envelope, centrosomes, kinetochores, kinetochore MTs, central spindle, astral MTs, and the cell cortex during mitosis. This localization pattern is in accordance with previous immunohistochemistry and overexpression studies (Schmidt et al., 2005; Nguyen-Ngoc et al., 2007; Gassmann et al., 2008; Kimura and Kimura, 2011). In addition, we noticed comet like accumulations of dynein radiating from the centrosomes to the cell periphery in a pattern that appeared to follow the mitotic astral MT network.Endogenous dynein complex tracks MT plus ends. This was observed in one cell embryos and in later stages of C. elegans embryos (4-cell embryos).

• Primary Identifier: Expr13343
• Subcellular Localization: We examined the subcellular localization of DHC-1 with a GFP::DHC-1 transgene expressed in DA9, and found that it is enriched at the dendrite terminal. GFP::DHC-1 is localized to the cytoplasm.

• Primary Identifier: Expr1157291
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1196
• Remark: A subcellular distribution analogous to the one reported here was observed in C. elegans embryos using polyclonal antibodies raised against purified dynein heavy chain protein.
• Subcellular Localization: Cytoplasmic dynein was present in a punctate manner throughout the cytoplasm at all stages of the cell cycle. A stronger signal was detected at the periphery of pronuclei in one cell stage embryos and of nuclei in later stage embryos. Cytoplasmic dynein was present at the cell cortex; especially apparent at boundaries between cells, for instance, between the AB and P1 blastomeres of the two cell stage embryo. The distribution of cytoplasmic dynein changed as cells progressed through mitosis. During prometaphase, cytoplasmic dynein accumulated along both sides of prometaphase chromosomes. During early anaphase, strong spindle signal was still detected, both between segregating chromosomes and spindle poles, as well as centrally, between the two sets of chromosomes. A similar staining pattern persisted throughout anaphase. At telophase, cytoplasmic dynein was enriched in two areas of the cytoplasm adjacent to the spindle poles. A strong signal was detected at the periphery of reforming nuclei.

• Primary Identifier: Expr3195
• Subcellular Localization: Affinity-purified antibodies revealed a distribution of DHC-1 in wild-type embryos similar to that described previously (See Expr1196): punctate in cytoplasm, an elevated concentration on nuclear envelopes during pronuclear migration, enrichment in the central spindle during metaphase, and faint enrichment over the entire anaphase spindle. A transient accumulation of DHC-1 was also noted in a narrow cortical zone between the AB and P1 cells during rotation of the P1 centrosome-centrosome axis onto the anterior-posterior (AP) axis.

• Primary Identifier: Expr15124

• Primary Identifier: Expr2029110
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr13457
• Subcellular Localization: DHC-1::GFP was readily detectable on growing MT plus ends in early embryos. dhc-1::gfp knock-in allele.

• Primary Identifier: Expr14489
• Subcellular Localization: DHC-1 was restricted within the dendrite and did not enter cilia.

• Primary Identifier: Expr13460
• Subcellular Localization: Time-lapse SDCM of eGFP::DHC-1 zygotes revealed no measurable enrichment of dynein at the cortex over cytoplasmic values during metaphase spindle displacement, similar to lin-5(RNAi) embryos. However, we observed transient regions of DHC-1 enrichment in cortical patches during late anaphase. These patches were most pronounced at the posterior cortex during spindle rocking and often followed the oscillatory behavior of the spindle poles

• Primary Identifier: Expr15668
• Subcellular Localization: In control embryos, GFP::DHC-1 was enriched at the nuclear envelope, the mitotic spindle, kinetochores and the cell cortex, and a similar localization pattern was observed in control spermatocytes of young adult males.

• Primary Identifier: Expr1023000
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr15669
• Subcellular Localization: In control embryos, GFP::DHC-1 was enriched at the nuclear envelope, the mitotic spindle, kinetochores and the cell cortex, and a similar localization pattern was observed in control spermatocytes of young adult males.

48 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000962
• Start: 4386785
• End: 4401907
• Strand: 1

48 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 15123

1 Sequence Ontology Term